Metellina curtisi

(McCook, 1894) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Tetragnathidae/Metellina

At a glance

Occurrence records336

Data sources8

Biological traits0

DNA specimens104

eDNA detections101

Sources8 archives

Databases and archives Metellina curtisi's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility336 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI101 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics104 specimens↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF336 records

Environmental DNA1 datasets · 2 countries101 detections

DNA & barcodingBOLD104 specimens

01Narrative

Metellina curtisi is a species of long-jawed orb weaver in the spider family Tetragnathidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding104 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Metellina curtisi has left across the world's sequence archives.

At a glance

DNA specimens104

BINs1

Marker genes1

eDNA detections101

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P657 bp consensus100 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 5 variable positions, in barcode order

111Gmostly conserved

165Gmostly conserved

240Gmostly conserved

351Cmostly conserved

372Amostly conserved

ACTTTATATTTTATTTTTGGTGCTTGAGCTGCGATAGTTGGGACGGCAATAAGAGTTTTGATTCGAATTGAATTAGGACAGTCGGGGAGA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.21%

Haplotypes10

BIN1

Most divergent pair2.1%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Metellina mimetoidessame genus10.2%Metellina mengeisame genus13.4%Metellina segmentatasame genus13.9%Agyneta nigripessame order14.0%Mecynargus morulussame order14.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type336 records

Wild obs. + sensor110

Museum / vouchered226

Range

Area of Occupancy AOO596 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 37≤1 km 18≤10 km 6>10 km 4

65 georeferenced · 45 without coordinates

Open the mapobservation + sensor110

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy94% within 1 km

≤100 m 31≤1 km 29≤10 km 4

64 georeferenced · 162 without coordinates

Open the institutions mapphysical evidence226

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Edmonton, CA	61
University of Guelph, Centre for Biodiversity Genomicslocation not on record	50
Denver, US	20
Chicago, US	7
Cambridge, US	2
Frankfurt am Main	2
San Francisco, US	1
University of Alaska Museumlocation not on record	1

8 institutions · 144 of 226 vouchered records shown · 82 without an institution code

09Environmental DNA101 detections

Where the DNA of Metellina curtisi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found101

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 101 detections have coordinates

Open the map2 countries0

old forestWetlandForestbog forest, zonal forest, bog woodlandBedrock, Blanket Bogblanket bog; bedrock

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.8 °C 12.2–15.6

Seasonal swing summer↔winter9.40 °C

Max temp (day)14.9 °C 14.7–18.6

Min temp (night)11.1 °C 9.50–13.4

Precipitation155 mm/mo 77.8–174

Air humidity65.8 % 63.0–67.9

Moisture balance37.2 mm/mo -37.6–94.7

Vapour deficit505 Pa 481–568

Wind speed1.60 m/s 1.50–4.40

Cloud cover43.5 % 35.7–43.5

CHELSA 1981–2010, ~9 km grid, at location & month of 101 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)