Metaxaglaea viatica

Grote, 1874 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Metaxaglaea

At a glance

Occurrence records678

Data sources7

Biological traits0

DNA specimens13

eDNA detections17

Sources7 archives

Databases and archives Metaxaglaea viatica's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility678 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI17 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF678 records

Environmental DNA1 datasets · 2 countries17 detections

DNA & barcodingBOLD13 specimens

01Narrative

Metaxaglaea viatica, the roadside sallow moth, is a moth of the family Noctuidae. It is found in North America, where it has been recorded from Alabama, Arkansas, Florida, Georgia, Illinois, Indiana, Kansas, Kentucky, Maine, Maryland, Massachusetts, Michigan, New Hampshire, New Jersey, North Carolina, Ohio, Oklahoma, South Carolina, Tennessee, Texas, Virginia, West Virginia and Wisconsin.mothphotographersgroup The wingspan is about 50 mm. The forewings are dull chestnut brown with purplish antemedial and pоstmedial lines. There are large orbicular and reniform spots that are darker than the ground colour and partly outlined with pale yellow. The hindwings are grey.Bug Guide Adults have been recorded on wing from September to March. The larvae feed on apple, crab apple, mountain ash and cherry.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Metaxaglaea viatica has left across the world's sequence archives.

At a glance

DNA specimens13

BINs1

Marker genes1

eDNA detections17

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus13 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 16 variable positions, in barcode order

43Gvariable

178Tmostly conserved

238Tmostly conserved

263Tmostly conserved

292Tmostly conserved

331Amostly conserved

367Tvariable

415Gmostly conserved

490Tmostly conserved

517Gmostly conserved

548Tmostly conserved

556Gmostly conserved

574Tmostly conserved

586Gmostly conserved

613Tmostly conserved

628Amostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGGACTTCATTAAGATTACTAATTCGTGCTGAATTAGGAAACCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.64%

Haplotypes8

BIN1

Most divergent pair1.4%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Metaxaglaea inultasame genus2.3%Metaxaglaea australissame genus2.7%Metaxaglaea semitariasame genus2.7%Metaxaglaea violaceasame genus2.7%Sericaglaea signatasame family5.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type678 records

Wild obs. + sensor287

Museum / vouchered391

Range

Area of Occupancy AOO884 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy76% within 1 km

≤100 m 123≤1 km 38≤10 km 30>10 km 21

212 georeferenced · 75 without coordinates

Open the mapobservation + sensor287

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy19% within 1 km

≤100 m 4≤1 km 65≤10 km 279>10 km 21

369 georeferenced · 22 without coordinates

Open the institutions mapphysical evidence391

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
New Haven, US	286
King Saud Universitylocation not on record	33
Mississippi State, US	33
Georgia Museum of Natural Historylocation not on record	14
East Lansing, US	12
CUlocation not on record	10
OSUClocation not on record	1
UDlocation not on record	1

8 institutions · 390 of 391 vouchered records shown · 1 without an institution code

09Environmental DNA17 detections

Where the DNA of Metaxaglaea viatica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found17

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 17 detections have coordinates

Open the map2 countries0

1. Forest & Woodland|1.4. Temperate Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.4 °C 4.40–19.0

Seasonal swing summer↔winter23.3 °C

Max temp (day)18.9 °C 7.70–24.5

Min temp (night)8.90 °C 1.90–14.8

Precipitation91.3 mm/mo 82.6–98.7

Air humidity57.4 % 54.9–59.7

Moisture balance7.60 mm/mo -29.1–42.2

Vapour deficit692 Pa 362–986

Wind speed3.20 m/s 2.50–4.30

Cloud cover37.5 % 35.3–52.5

CHELSA 1981–2010, ~9 km grid, at location & month of 17 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)