Metaxaglaea inulta

Grote, 1874 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Metaxaglaea

At a glance

Occurrence records829

Data sources7

Biological traits0

DNA specimens13

eDNA detections13

Sources7 archives

Databases and archives Metaxaglaea inulta's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility829 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI13 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF829 records

Environmental DNA1 datasets · 2 countries13 detections

DNA & barcodingBOLD13 specimens

01Narrative

The unsated sallow or arrowwood sallow (Metaxaglaea inulta) is a moth of the family Noctuidae. It is found from Nova Scotia to North Carolina, west to Missouri, north to Manitoba. The wingspan is 40–48 mm. Adults are on wing from late August to November. The larvae feed on the leaves of Viburnum species, including Viburnum dentatum, Viburnum lentago and Viburnum lantana.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Metaxaglaea inulta has left across the world's sequence archives.

At a glance

DNA specimens13

BINs1

Marker genes1

eDNA detections13

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus13 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 7 variable positions, in barcode order

39Tmostly conserved

58Amostly conserved

175Amostly conserved

291Tvariable

616Cvariable

652Tmostly conserved

653Cmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACTTCATTAAGATTACTAATTCGTGCTGAATTAGGAAACCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.29%

Haplotypes3

BIN1

Most divergent pair0.46%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Metaxaglaea viaticasame genus2.3%Metaxaglaea violaceasame genus2.6%Eupsilia transversasame family4.4%Sericaglaea signatasame family4.4%Mesogona oxalinasame family4.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type829 records

Wild obs. + sensor456

Museum / vouchered373

Range

Area of Occupancy AOO1 344 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 284≤1 km 63≤10 km 18>10 km 19

384 georeferenced · 72 without coordinates

Open the mapobservation + sensor456

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy40% within 1 km

≤100 m 29≤1 km 97≤10 km 174>10 km 17

317 georeferenced · 56 without coordinates

Open the institutions mapphysical evidence373

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
New Haven, US	190
East Lansing, US	104
University of Alberta Museums (UAM)location not on record	18
Cleveland Museum of Natural History, OH (CLEV)location not on record	9
St. Paul, US	9
Cambridge, US	4
OSUClocation not on record	4
University of Guelph, Centre for Biodiversity Genomicslocation not on record	4
Cornell University Insect Collectionlocation not on record	3
SOVTlocation not on record	3
Colorado State Universitylocation not on record	2
Toronto, CA	2
Albuquerque, US	1
UDlocation not on record	1
Georgia Museum of Natural Historylocation not on record	1

15 institutions · 355 of 373 vouchered records shown · 18 without an institution code

09Environmental DNA13 detections

Where the DNA of Metaxaglaea inulta was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found13

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 13 detections have coordinates

Open the map2 countries0

Temperate mixed forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.2 °C 9.50–17.4

Seasonal swing summer↔winter28.3 °C

Max temp (day)19.0 °C 14.6–22.7

Min temp (night)10.9 °C 6.30–13.0

Precipitation110 mm/mo 75.5–112

Air humidity60.5 % 57.6–60.9

Moisture balance28.9 mm/mo -10.8–36.3

Vapour deficit647 Pa 479–789

Wind speed3.20 m/s 2.30–3.70

Cloud cover51.6 % 45.5–55.1

CHELSA 1981–2010, ~9 km grid, at location & month of 13 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)