Metarranthis refractaria

(Guenée) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Geometridae/Metarranthis

At a glance

Occurrence records423

Data sources7

Biological traits0

DNA specimens45

eDNA detections42

Sources7 archives

Databases and archives Metarranthis refractaria's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility423 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI42 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics45 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF423 records

Environmental DNA1 datasets · 2 countries42 detections

DNA & barcodingBOLD45 specimens

01Narrative

Metarranthis refractaria, the refracted metarranthis, is a species of geometrid moth in the family Geometridae. It is found in North America. The MONA or Hodges number for Metarranthis refractaria is 6827.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding45 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Metarranthis refractaria has left across the world's sequence archives.

At a glance

DNA specimens45

BINs2

Marker genes1

eDNA detections42

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus41 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 15 variable positions, in barcode order

76Avariable

100Gmostly conserved

166Gmostly conserved

212Cmostly conserved

220Cmostly conserved

229Amostly conserved

271Avariable

286Amostly conserved

316Gmostly conserved

412Gmostly conserved

451Cmostly conserved

481Amostly conserved

511Gmostly conserved

565Gmostly conserved

578Tvariable

AACATTATATTTCATTTTTGGGATTTGAGCAGGAATAGTAGGAACTTCTTTAAGACTTTTAATTCGAGCTGAATTAGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.57%

Haplotypes9

BINs2

Most divergent pair2.1%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Metarranthis mestusatasame genus1.5%Metarranthis indeclinatasame genus1.8%Metarranthis hypochariasame genus2.6%Metarranthis homurariasame genus3.2%Metarranthis lateritiariasame genus3.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type423 records

Wild obs. + sensor209

Museum / vouchered214

Range

Area of Occupancy AOO1 100 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 107≤1 km 37≤10 km 10>10 km 20

174 georeferenced · 35 without coordinates

Open the mapobservation + sensor209

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy23% within 1 km

≤100 m 3≤1 km 28≤10 km 64>10 km 42

137 georeferenced · 77 without coordinates

Open the institutions mapphysical evidence214

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cambridge, US	64
New Haven, US	47
East Lansing, US	46
Washington, US	20
University of Guelph, Centre for Biodiversity Genomicslocation not on record	10
Cleveland Museum of Natural History, OH (CLEV)location not on record	4
Smithsonian Institution, National Museum of Natural Historylocation not on record	1
St. Paul, US	1
Saint John, CA	1

9 institutions · 194 of 214 vouchered records shown · 20 without an institution code

09Environmental DNA42 detections

Where the DNA of Metarranthis refractaria was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found42

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 42 detections have coordinates

Open the map2 countries0

ForestMixed habitatTemperate mixed forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.7 °C 16.0–18.4

Seasonal swing summer↔winter26.4 °C

Max temp (day)21.9 °C 20.2–23.5

Min temp (night)14.2 °C 11.7–14.2

Precipitation84.7 mm/mo 84.7–113

Air humidity57.7 % 57.3–59.0

Moisture balance-57.7 mm/mo -57.7–-24.0

Vapour deficit855 Pa 700–869

Wind speed2.90 m/s 2.70–3.70

Cloud cover41.1 % 41.0–43.1

CHELSA 1981–2010, ~9 km grid, at location & month of 41 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)