Metarranthis indeclinata

Walker, 1861 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Geometridae/Metarranthis

At a glance

Occurrence records295

Data sources7

Biological traits0

DNA specimens72

eDNA detections71

Sources7 archives

Databases and archives Metarranthis indeclinata's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility295 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI71 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics72 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF295 records

Environmental DNA1 datasets · 2 countries71 detections

DNA & barcodingBOLD72 specimens

01Narrative

Metarranthis indeclinata, the pale metarranthi, is a species of geometrid moth in the family Geometridae. It is found in North America. The MONA or Hodges number for Metarranthis indeclinata is 6825.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding72 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Metarranthis indeclinata has left across the world's sequence archives.

At a glance

DNA specimens72

BINs2

Marker genes4

eDNA detections71

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus62 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 19 variable positions, in barcode order

22Gmostly conserved

211Amostly conserved

212Tmostly conserved

220Tmostly conserved

229Gmostly conserved

244Amostly conserved

286Gmostly conserved

316Amostly conserved

364Tmostly conserved

370Amostly conserved

412Cmostly conserved

421Cmostly conserved

433Gmostly conserved

436Cmostly conserved

451Tmostly conserved

481Gmostly conserved

505Cmostly conserved

511Amostly conserved

571Cmostly conserved

AACATTATATTTCATTTTTGGGATTTGAGCAGGAATAGTAGGAACTTCTTTAAGACTTTTAATTCGAGCTGAATTAGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.90%

Haplotypes14

BINs2

Most divergent pair2.9%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Metarranthis mestusatasame genus1.8%Metarranthis refractariasame genus1.8%Metarranthis hypochariasame genus3.2%Metarranthis homurariasame genus3.3%Metarranthis lateritiariasame genus3.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P★ITS18S

animal barcodefungal barcoderibosomal

08Occurrence & distribution

Record type295 records

Wild obs. + sensor139

Museum / vouchered156

Range

Area of Occupancy AOO732 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 71≤1 km 18≤10 km 12>10 km 8

109 georeferenced · 30 without coordinates

Open the mapobservation + sensor139

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy14% within 1 km

≤100 m 1≤1 km 9≤10 km 54>10 km 7

71 georeferenced · 85 without coordinates

Open the institutions mapphysical evidence156

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
New Haven, US	62
University of Guelph, Centre for Biodiversity Genomicslocation not on record	24
East Lansing, US	7
Saint John, CA	4
Washington, US	3
Toronto, CA	2
Canadian Forest Service, Northern Forestry Centrelocation not on record	1
OSUClocation not on record	1
Cornell University Insect Collectionlocation not on record	1
Centre for Biodiversity Genomicslocation not on record	1
Canadian National Collection of Insects, Arachnids and Nematodeslocation not on record	1

11 institutions · 107 of 156 vouchered records shown · 49 without an institution code

09Environmental DNA71 detections

Where the DNA of Metarranthis indeclinata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found71

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 71 detections have coordinates

Open the map2 countries0

GrasslandForestTemperate mixed forestMaritime heathlandRiparian Zone

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.7 °C 13.4–18.2

Seasonal swing summer↔winter26.4 °C

Max temp (day)21.8 °C 17.0–23.7

Min temp (night)13.1 °C 9.80–15.1

Precipitation89.3 mm/mo 79.5–118

Air humidity57.7 % 56.5–64.6

Moisture balance-39.2 mm/mo -61.2–8.80

Vapour deficit792 Pa 566–888

Wind speed3.10 m/s 2.40–4.40

Cloud cover42.2 % 41.1–48.6

CHELSA 1981–2010, ~9 km grid, at location & month of 68 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)