Mesogona olivata

Harvey, 1874 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Mesogona

At a glance

Occurrence records602

Data sources7

Biological traits0

DNA specimens46

eDNA detections66

Sources7 archives

Databases and archives Mesogona olivata's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility602 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI66 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics46 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF602 records

Environmental DNA1 datasets · 2 countries66 detections

DNA & barcodingBOLD46 specimens

01Narrative

Mesogona olivata is a moth of the family Noctuidae. It is found from southern coastal and interior British Columbia south through California, Colorado and Texas. It most likely also occurs in northern Mexico. The wingspan is about 36 mm. Adults are on wing from August to November. The larvae feed on various deciduous shrubs and trees, including poplar, oak, hazel, amelanchier, alder, antelope brush, Symphoricarpos, and Berberis. It has been reared from Quercus garryana, Ceanothus velutinus and Quercus agrifolia.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding46 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Mesogona olivata has left across the world's sequence archives.

At a glance

DNA specimens46

BINs3

Marker genes1

eDNA detections66

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus45 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 87% of positions are identical in every specimen.

Where individuals differ — all 88 variable positions, in barcode order

2Amostly conserved

3Cmostly conserved

4Amostly conserved

7Amostly conserved

8Tmostly conserved

9Amostly conserved

14Amostly conserved

15Tmostly conserved

16Tmostly conserved

17Tmostly conserved

20Gmostly conserved

22Amostly conserved

23Amostly conserved

24Tmostly conserved

25Tvariable

26Tmostly conserved

29Gmostly conserved

30Cmostly conserved

33Gmostly conserved

34Amostly conserved

35Amostly conserved

36Tmostly conserved

38Gmostly conserved

39Tmostly conserved

40Tvariable

41Gmostly conserved

42Gmostly conserved

44Amostly conserved

45Cmostly conserved

46Tmostly conserved

47Tmostly conserved

48Cmostly conserved

53Amostly conserved

54Gmostly conserved

56Tmostly conserved

58Amostly conserved

60Tmostly conserved

61Amostly conserved

62Amostly conserved

63Tmostly conserved

65Cmostly conserved

66Gmostly conserved

67Tmostly conserved

68Gmostly conserved

69Cmostly conserved

70Tmostly conserved

72Amostly conserved

74Tmostly conserved

75Tmostly conserved

76Amostly conserved

77Gmostly conserved

78Gmostly conserved

79Amostly conserved

80Amostly conserved

81Amostly conserved

127Cmostly conserved

130Avariable

178Tvariable

202Cmostly conserved

205Cvariable

214Avariable

220Cvariable

229Avariable

235Tvariable

263Cmostly conserved

268Cvariable

271Tvariable

274Tvariable

287Tmostly conserved

292Cmostly conserved

313Tvariable

325Avariable

337Gvariable

340Cvariable

364Tvariable

400Cvariable

403Avariable

415Tvariable

463Tvariable

478Tvariable

517Tvariable

548Cmostly conserved

556Cvariable

562Tvariable

574Cvariable

616Cvariable

619Tmostly conserved

646Tmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTTGGAACTTCATTAAGATTACTAATTCGTGCTGAATTAGGAAACCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.6%

Haplotypes15

BINs3

Most divergent pair4.6%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Mesogona oxalinasame genus4.3%Rhiza commodasame family4.3%Mesogona acetosellaesame genus4.6%Rhiza stenopterasame family4.6%Sericaglaea signatasame family4.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type602 records

Wild obs. + sensor103

Museum / vouchered499

Range

Area of Occupancy AOO908 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy70% within 1 km

≤100 m 45≤1 km 8≤10 km 16>10 km 7

76 georeferenced · 27 without coordinates

Open the mapobservation + sensor103

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy58% within 1 km

≤100 m 92≤1 km 97≤10 km 112>10 km 25

326 georeferenced · 173 without coordinates

Open the institutions mapphysical evidence499

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Colorado State Universitylocation not on record	173
San Diego, US	89
Oregon State Arthropod Collectionlocation not on record	80
New Haven, US	70
Mississippi State, US	15
Vernal, US	11
ASUlocation not on record	8
East Lansing, US	7
Santa Cruz, US	6
San Francisco, US	5
Denver, US	3
WWUlocation not on record	3
University of Alberta Museums (UAM)location not on record	2
Awka, NG	1
Centre for Biodiversity Genomics, Informatics Departmentlocation not on record	1
US	1
St. Paul, US	1
München, DE	1

18 institutions · 477 of 499 vouchered records shown · 22 without an institution code

09Environmental DNA66 detections

Where the DNA of Mesogona olivata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found66

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 66 detections have coordinates

Open the map2 countries0

red calcareous sandy soil, juniper, mtn. mah…riparian areaforestPinesEricameria, pine, oak, juniperpoplar, oak, Ericameria

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.8 °C 7.60–18.6

Seasonal swing summer↔winter19.7 °C

Max temp (day)21.6 °C 12.5–25.5

Min temp (night)10.2 °C 2.60–13.6

Precipitation28.4 mm/mo 12.5–77.0

Air humidity52.7 % 43.1–60.7

Moisture balance-75.7 mm/mo -108–-2.40

Vapour deficit792 Pa 448–1,222

Wind speed2.80 m/s 1.50–4.60

Cloud cover28.7 % 19.6–51.1

CHELSA 1981–2010, ~9 km grid, at location & month of 62 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)