Mesogona acetosellae

(Denis & Schiffermüller) , 1775 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Mesogona

At a glance

Occurrence records1 396

Data sources9

Biological traits0

DNA specimens36

eDNA detections22

Sources9 archives

Databases and archives Mesogona acetosellae's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 396 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI22 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics36 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 396 records

Environmental DNA1 datasets · 7 countries22 detections

DNA & barcodingBOLD36 specimens

Genome at a glanceGoaT · NCBI≈623 Mbp

01Narrative

The pale stigma (Mesogona acetosellae) is a moth of the family Noctuidae. It is found in central and southern Europe, Turkey, the Caucasus, Armenia, Kazakhstan and from western Siberia to the Altai.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding36 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Mesogona acetosellae has left across the world's sequence archives.

At a glance

DNA specimens36

BINs1

Marker genes14

eDNA detections22

Countries8

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus23 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 4 variable positions, in barcode order

172Tvariable

271Cmostly conserved

318Cmostly conserved

358Tvariable

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACTTCATTAAGATTACTAATTCGTGCTGAATTAGGAACCCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.24%

Haplotypes3

BIN1

Most divergent pair0.46%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Mesogona oxalinasame genus3.0%Eupsilia transversasame family3.8%Eupsilia sidussame family4.4%Xylena formosasame family4.4%Eupsilia tristigmatasame family4.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P16Satp6ATP8COIICOXIIICYTBND1ND2ND3ND4ND4LND6MT-NADH5

animal barcoderibosomalmitochondrialmarker

06Genome at a glanceGoaT · NCBI

The complete instruction manual Mesogona acetosellae carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈622 525 992 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Mesogona acetosellae0.62 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness99.8% BUSCO

08Occurrence & distribution

Record type1 396 records

Wild obs. + sensor532

Museum / vouchered525

Other339

Origin

Native163

Range

Area of Occupancy AOO1 988 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy58% within 1 km

≤100 m 115≤1 km 126≤10 km 170>10 km 7

418 georeferenced · 114 without coordinates

Open the mapobservation + sensor532

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy44% within 1 km

≤100 m 2≤1 km 154≤10 km 196>10 km 2

354 georeferenced · 171 without coordinates

Open the institutions mapphysical evidence525

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Provincia di Livornolocation not on record	158
Helsinki, FI	141
Bern, CH	32
SFRAlocation not on record	26
Paro, BT	20
Sion, CH	19
Zürich, CH	9
UMUlocation not on record	8
Muzeum Górnośląskie w Bytomiulocation not on record	6
Frauenfeld, CH	5
Musee d'Histoire Naturallelocation not on record	4
Geneva, CH	4
Naturéum — Muséum cantonal des sciences naturelles, Lausanne, Département Zoologielocation not on record	4
Tartu, EE	2
Philadelphia, US	2
ZSMlocation not on record	2
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	2
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	2
Dhaka, BD	2
Naturmuseum St. Gallenlocation not on record	2
МПХУlocation not on record	1
Radicondoli, IT	1

22 institutions · 452 of 525 vouchered records shown · 73 without an institution code

09Environmental DNA22 detections

Where the DNA of Mesogona acetosellae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found22

Studies independent surveys1

Countries7

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 22 detections have coordinates

Open the map7 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.0 °C 13.2–17.4

Seasonal swing summer↔winter18.4 °C

Max temp (day)19.5 °C 17.5–22.0

Min temp (night)10.2 °C 8.20–12.5

Precipitation75.4 mm/mo 64.2–114

Air humidity59.0 % 54.2–61.5

Moisture balance-14.0 mm/mo -33.2–56.9

Vapour deficit695 Pa 622–853

Wind speed2.70 m/s 1.50–4.10

Cloud cover39.4 % 30.1–42.1

CHELSA 1981–2010, ~9 km grid, at location & month of 22 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Mesogona acetosellae

At a glance

Sources9 archives

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type1 396 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions11 of 22 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 396 records