Megachile nigriventris

Schenck, 1870 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Megachilidae/Megachile

At a glance

Occurrence records1 942

Data sources7

Biological traits3

DNA specimens22

eDNA detections21

Sources7 archives

Databases and archives Megachile nigriventris's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 942 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI21 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics22 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources3 traits

Occurrence & distributionGBIF1 942 records

Environmental DNA1 datasets · 6 countries21 detections

DNA & barcodingBOLD22 specimens

01Narrative

Megachile nigriventris is a species of bee in the family Megachilidae. It was described by Schenck in 1870.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesBeeMorph

Size & morphology3

Hair length0.56 mm

Intertegular distance (ITD)3.5 mm

Tongue length7.08 mm

05DNA & barcoding22 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Megachile nigriventris has left across the world's sequence archives.

At a glance

DNA specimens22

BINs3

Marker genes1

eDNA detections21

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus19 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Diversity (π)2.3%

Haplotypes2

BINs3

Most divergent pair11.1%

Where individuals differ — all 39 variable positions, in barcode order

10Cmostly conserved

16Cmostly conserved

22Amostly conserved

23Tmostly conserved

28Amostly conserved

29Tmostly conserved

31Gmostly conserved

55Tmostly conserved

74Cmostly conserved

81Tmostly conserved

82Cmostly conserved

88Tmostly conserved

118Cmostly conserved

121Amostly conserved

136Tmostly conserved

142Cmostly conserved

181Amostly conserved

206Cmostly conserved

223Amostly conserved

293Tmostly conserved

294Cmostly conserved

309Amostly conserved

367Tmostly conserved

373Tmostly conserved

379Tmostly conserved

386Tmostly conserved

454Tmostly conserved

475Tmostly conserved

548Cmostly conserved

550Tmostly conserved

556Tmostly conserved

562Tmostly conserved

581Cmostly conserved

604Amostly conserved

619Tmostly conserved

628Amostly conserved

631Tmostly conserved

634Cmostly conserved

652Cmostly conserved

AATATTATACATAATCTTTGCATTATGATCGGGAATAATTGGATCAAGTTTATCTATAATTATTCGAATAGAACTAAGAATCCCAGGTTC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Megachile maritimasame genus5.0%Megachile analissame genus5.7%Megachile gemulasame genus5.8%Megachile willughbiellasame genus5.8%Megachile frigidasame genus6.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 942 records

Wild obs. + sensor714

Museum / vouchered1 215

Cultivated / captive1

Other12

Origin

Native438

Range

Area of Occupancy AOO3 548 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy61% within 1 km

≤100 m 263≤1 km 157≤10 km 265>10 km 4

689 georeferenced · 25 without coordinates

Open the mapobservation + sensor714

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy21% within 1 km

≤100 m 140≤1 km 102≤10 km 885>10 km 21

1 148 georeferenced · 67 without coordinates

Open the institutions mapphysical evidence1 215

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 36 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	190
SLU Artdatabankenlocation not on record	125
Bern, CH	112
Zürich, CH	105
Musee d'Histoire Naturallelocation not on record	93
Paro, BT	30
Philadelphia, US	21
Provincia di Livornolocation not on record	19
Naturéum — Muséum cantonal des sciences naturelles, Lausanne, Département Zoologielocation not on record	18
Trondheim, NO	17
ZMAAlocation not on record	11
neflocation not on record	11
NHMOlocation not on record	10
PRUNlocation not on record	9
Dhaka, BD	8
PRAZlocation not on record	8
Museum zu Allerheiligen Schaffhausenlocation not on record	7
BioFokuslocation not on record	6
Geneva, CH	6
Universität Zürich, Naturhistorisches Museumlocation not on record	5
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	4
ZSMlocation not on record	4
NMBU:MINAlocation not on record	3
Cambridge, US	3
KZMlocation not on record	2
Winterthur, CH	2
ARTlocation not on record	2
Naturkundliche Sammlung Urilocation not on record	2
MZLUlocation not on record	2
MNHWlocation not on record	1
Beltsville, US	1
	1
Kuopio, FI	1
NMOKlocation not on record	1
Bavarian State Collection of Zoologylocation not on record	1
Naturhistorisches Museum Wienlocation not on record	1

36 institutions · 842 of 1 215 vouchered records shown · 373 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA21 detections

Where the DNA of Megachile nigriventris was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found21

Studies independent surveys1

Countries6

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 21 detections have coordinates

Open the map6 countries0

Urban

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.9 °C 6.90–15.9

Seasonal swing summer↔winter19.5 °C

Max temp (day)17.9 °C 11.2–19.9

Min temp (night)8.40 °C 0.4–10.9

Precipitation95.6 mm/mo 64.1–252

Air humidity58.8 % 57.3–65.0

Moisture balance-19.7 mm/mo -56.1–162

Vapour deficit631 Pa 390–734

Wind speed3.40 m/s 2.40–6.50

Cloud cover39.8 % 34.6–43.8

CHELSA 1981–2010, ~9 km grid, at location & month of 21 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Megachile nigriventris

At a glance

Sources7 archives

Size & morphology3

At a glance

Record type1 942 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions13 of 36 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 942 records