Megachile gemula

Cresson, 1878 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Megachilidae/Megachile

At a glance

Occurrence records1 068

Data sources7

Biological traits1

DNA specimens26

eDNA detections33

Sources7 archives

Databases and archives Megachile gemula's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 068 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI33 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics26 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF1 068 records

Environmental DNA1 datasets · 2 countries33 detections

DNA & barcodingBOLD26 specimens

01Narrative

Megachile gemula is a species of bee in the family Megachilidae. It was described by Cresson in 1878.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesBeeMorph

Size & morphology1

Intertegular distance (ITD)3.64 mm

05DNA & barcoding26 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Megachile gemula has left across the world's sequence archives.

At a glance

DNA specimens26

BINs2

Marker genes1

eDNA detections33

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus23 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 11 variable positions, in barcode order

43Tvariable

130Tvariable

133Tvariable

206Tvariable

235Cmostly conserved

301Cvariable

457Tvariable

505Cvariable

547Tvariable

637Tvariable

646Tvariable

AATATTATATATAATTTTTGCATTATGAGCAGGAATAATTGGTTCAAGATTATCAATAATTATTCGAATAGAATTAAGAATCCCAGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.85%

Haplotypes6

BINs2

Most divergent pair1.8%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Megachile analissame genus3.8%Megachile circumcinctasame genus4.9%Megachile maritimasame genus5.3%Megachile melanophaeasame genus5.5%Megachile willughbiellasame genus5.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 068 records

Wild obs. + sensor68

Museum / vouchered1 000

Range

Area of Occupancy AOO2 156 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 31≤1 km 16≤10 km 4>10 km 3

54 georeferenced · 14 without coordinates

Open the mapobservation + sensor68

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy38% within 1 km

≤100 m 17≤1 km 120≤10 km 186>10 km 33

356 georeferenced · 644 without coordinates

Open the institutions mapphysical evidence1 000

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions22 of 39 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
East Lansing, US	156
US	110
Beltsville, US	97
Wuzhou, CN	89
White River Junction, US	51
University Park, US	47
BBSLlocation not on record	40
Lexington, US	34
Champaign, US	27
OSUClocation not on record	25
Cornell University Insect Collectionlocation not on record	23
Oregon State Arthropod Collectionlocation not on record	22
Cambridge, US	20
Toronto, CA	19
Cleveland Museum of Natural History, OH (CLEV)location not on record	19
New Haven, US	16
	14
University of Guelphlocation not on record	12
WIlocation not on record	11
New Haven, US	8
FWSlocation not on record	7
Zadock Thompson Natural History Collection, University of Vermontlocation not on record	6
UNHClocation not on record	6
Chicago, US	6
Santa Cruz, US	6
Philadelphia, US	6
Montgomery, US	5
Roberts Creek, CA	4
Weber State University, Bird and Mammal Collectionlocation not on record	4
Vancouver, CA	3
Vermont Center for Ecostudieslocation not on record	3
UTSClocation not on record	3
Middlebury Collegelocation not on record	2
WSUClocation not on record	2
Saint John, CA	2
Blacksburg, US	1
SUNY ESFlocation not on record	1
Philadelphia, US	1
University of Alberta Museums (UAM)location not on record	1

39 institutions · 909 of 1 000 vouchered records shown · 91 without an institution code

09Environmental DNA33 detections

Where the DNA of Megachile gemula was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found33

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 33 detections have coordinates

Open the map2 countries0

Agriculture field4. Native Grassland | 4.4. Temperate GrasslandTemperate mixed forestfarm

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.4 °C 0–19.4

Seasonal swing summer↔winter25.1 °C

Max temp (day)22.6 °C 4.70–25.3

Min temp (night)9.20 °C -4.10–15.9

Precipitation85.7 mm/mo 38.5–113

Air humidity59.2 % 51.3–66.3

Moisture balance-27.8 mm/mo -109–25.9

Vapour deficit789 Pa 335–996

Wind speed2.60 m/s 1.50–4.20

Cloud cover42.4 % 34.6–56.9

CHELSA 1981–2010, ~9 km grid, at location & month of 28 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Megachile gemula

At a glance

Sources7 archives

Size & morphology1

At a glance

Record type1 068 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions22 of 39 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 068 records