Megachile frontalis

(Fabricius, 1804) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Megachilidae/Megachile

At a glance

Occurrence records197

Data sources7

Biological traits0

DNA specimens16

eDNA detections6

Sources7 archives

Databases and archives Megachile frontalis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility197 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics16 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF197 records

Environmental DNA1 datasets · 2 countries6 detections

DNA & barcodingBOLD16 specimens

01Narrative

Megachile frontalis is a species of bee in the family Megachilidae. It was described by Johan Christian Fabricius in 1804.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding16 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Megachile frontalis has left across the world's sequence archives.

At a glance

DNA specimens16

BINs4

Marker genes1

eDNA detections6

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus14 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 70% of positions are identical in every specimen.

Where individuals differ — all 195 variable positions, in barcode order

1Tmostly conserved

5Cmostly conserved

7Tmostly conserved

10Tmostly conserved

14Amostly conserved

16Tmostly conserved

21Cmostly conserved

22Cmostly conserved

23Cmostly conserved

24Tmostly conserved

25Tmostly conserved

27Gmostly conserved

28Amostly conserved

29Gmostly conserved

31Tmostly conserved

32Gmostly conserved

34Amostly conserved

38Amostly conserved

40Tmostly conserved

43Tmostly conserved

44Tmostly conserved

46Amostly conserved

47Amostly conserved

48Gmostly conserved

49Amostly conserved

50Tmostly conserved

53Tmostly conserved

54Cmostly conserved

55Amostly conserved

56Amostly conserved

61Tmostly conserved

67Tmostly conserved

79Amostly conserved

82Amostly conserved

85Tvariable

89Tmostly conserved

90Cmostly conserved

91Amostly conserved

100Amostly conserved

112Tmostly conserved

121Amostly conserved

122Amostly conserved

124Tmostly conserved

127Tmostly conserved

130Amostly conserved

131Tmostly conserved

133Amostly conserved

139Amostly conserved

142Tmostly conserved

154Tmostly conserved

158Tmostly conserved

160Amostly conserved

163Amostly conserved

169Tmostly conserved

172Cmostly conserved

181Amostly conserved

184Amostly conserved

197Tmostly conserved

202Amostly conserved

205Tmostly conserved

206Tmostly conserved

212Amostly conserved

214Tmostly conserved

217Tmostly conserved

218Gmostly conserved

220Amostly conserved

223Tmostly conserved

230Gmostly conserved

232Tmostly conserved

235Tmostly conserved

238Amostly conserved

242Amostly conserved

251Gmostly conserved

253Amostly conserved

256Amostly conserved

263Tmostly conserved

265Amostly conserved

271Tmostly conserved

274Cmostly conserved

277Cvariable

281Amostly conserved

283Tmostly conserved

284Tmostly conserved

293Amostly conserved

294Tmostly conserved

295Amostly conserved

301Cvariable

304Tmostly conserved

305Amostly conserved

307Amostly conserved

308Amostly conserved

309Cmostly conserved

310Cmostly conserved

311Cmostly conserved

312Cmostly conserved

313Amostly conserved

315Gmostly conserved

316Amostly conserved

322Amostly conserved

325Amostly conserved

334Amostly conserved

337Amostly conserved

340Tmostly conserved

343Tmostly conserved

346Amostly conserved

352Cvariable

354Tmostly conserved

356Tmostly conserved

359Amostly conserved

363Amostly conserved

364Tmostly conserved

367Tmostly conserved

368Cmostly conserved

370Tmostly conserved

373Cvariable

380Avariable

382Tmostly conserved

389Amostly conserved

391Amostly conserved

397Tmostly conserved

+75 more variable positions not shown

TATACTTTATATAATTTTTGCCCTTTGAGCTGGAATAATTGGTTCAAGATTATCAATAATTATTCGTATAGAATTAAGAACACCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)6.6%

Haplotypes3

BINs4

Most divergent pair14.4%

Africa

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Megachile malangensissame genus7.9%Megachile australissame genus8.3%Megachile chrysopygasame genus8.4%Megachile anatolicasame genus8.5%Megachile leachellasame genus9.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type197 records

Wild obs. + sensor10

Museum / vouchered187

Range

Area of Occupancy AOO448 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy50% within 1 km

≤100 m 2≤1 km 1≤10 km 1>10 km 2

6 georeferenced · 4 without coordinates

Open the mapobservation + sensor10

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 187 records without

Open the institutions mapphysical evidence187

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Sydney, AU	127
Cape Town, ZA	25
	22
Atlantic Reference Centrelocation not on record	8
Agricultural Research Council, South Africalocation not on record	3
Beltsville, US	2

6 institutions · 187 of 187 vouchered records shown

09Environmental DNA6 detections

Where the DNA of Megachile frontalis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.0 °C 16.7–23.8

Seasonal swing summer↔winter13.8 °C

Max temp (day)26.4 °C 24.2–29.4

Min temp (night)12.9 °C 9.50–17.4

Precipitation33.8 mm/mo 12.8–49.4

Air humidity47.8 % 46.4–57.5

Moisture balance-105 mm/mo -164–-96.6

Vapour deficit1,153 Pa 963–1,480

Wind speed3.20 m/s 2.00–4.00

Cloud cover19.7 % 10.1–33.9

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)