Megachile leachella

Curtis, 1828 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Megachilidae/Megachile

At a glance

Occurrence records4 368

Data sources9

Biological traits0

DNA specimens73

eDNA detections68

Sources9 archives

Databases and archives Megachile leachella's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 368 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI68 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics73 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF4 368 records

Environmental DNA1 datasets · 13 countries68 detections

DNA & barcodingBOLD73 specimens

Genome at a glanceGoaT · NCBI≈573 Mbp

01Narrative

Megachile leachella is a species of bee in the family Megachilidae. It was described by John Curtis in 1828.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding73 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Megachile leachella has left across the world's sequence archives.

At a glance

DNA specimens73

BINs4

Marker genes1

eDNA detections68

Countries15

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus68 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 93% of positions are identical in every specimen.

Where individuals differ — all 47 variable positions, in barcode order

1Tmostly conserved

4Amostly conserved

7Amostly conserved

8Tmostly conserved

9Amostly conserved

10Tmostly conserved

11Amostly conserved

13Amostly conserved

14Amostly conserved

15Tmostly conserved

16Tmostly conserved

17Tmostly conserved

18Tmostly conserved

19Tmostly conserved

21Cmostly conserved

22Cvariable

23Cmostly conserved

25Cmostly conserved

28Gvariable

30Cmostly conserved

31Amostly conserved

44Tmostly conserved

45Cmostly conserved

48Gmostly conserved

59Amostly conserved

67Tmostly conserved

82Cmostly conserved

85Tmostly conserved

91Amostly conserved

114Amostly conserved

127Amostly conserved

143Tmostly conserved

235Cmostly conserved

271Tmostly conserved

283Cmostly conserved

302Tmostly conserved

335Gvariable

337Cvariable

433Amostly conserved

451Tmostly conserved

505Tmostly conserved

547Cmostly conserved

580Amostly conserved

619Cmostly conserved

628Gmostly conserved

634Tmostly conserved

646Cmostly conserved

TATATTATATATAATTTTTGCCCTCTGGGCAGGAATAATTGGATCAAGATTATCAATAATTATTCGTATAGAATTAAGAACCCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.6%

Haplotypes11

BINs3

Most divergent pair9.7%

EuropeAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Megachile venustasame genus4.5%Megachile anatolicasame genus4.9%Megachile concinnasame genus5.3%Megachile pusillasame genus5.3%Megachile leucostomasame genus6.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Megachile leachella carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈572 960 844 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Megachile leachella0.57 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

08Occurrence & distribution

Record type4 368 records

Wild obs. + sensor3 009

Museum / vouchered1 219

Other140

Origin

Native279

Range

Area of Occupancy AOO3 980 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy38% within 1 km

≤100 m 754≤1 km 340≤10 km 1 781>10 km 6

2 881 georeferenced · 128 without coordinates

Open the mapobservation + sensor3 009

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy19% within 1 km

≤100 m 60≤1 km 136≤10 km 844>10 km 15

1 055 georeferenced · 164 without coordinates

Open the institutions mapphysical evidence1 219

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions18 of 43 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
SLU Artdatabankenlocation not on record	221
Zürich, CH	128
Bern, CH	80
Adam Mickiewicz University in Poznańlocation not on record	56
Naturéum — Muséum cantonal des sciences naturelles, Lausanne, Département Zoologielocation not on record	49
ULglocation not on record	40
Paro, BT	38
Museum zu Allerheiligen Schaffhausenlocation not on record	35
Philadelphia, US	34
Muzeum Górnośląskie w Bytomiulocation not on record	26
Natural History Museum Rotterdamlocation not on record	26
IENElocation not on record	25
NMOKlocation not on record	21
Coimbra, PT	21
	18
Provincia di Livornolocation not on record	16
Musee d'Histoire Naturallelocation not on record	16
IMEDEAlocation not on record	15
South Kensington, GB	14
MNHWlocation not on record	11
Geneva, CH	8
Tilburg, NL	8
Cambridge, US	8
NCMGlocation not on record	6
PRAZlocation not on record	6
Brussels, BE	5
CBDClocation not on record	4
Beltsville, US	4
Universität Zürich, Naturhistorisches Museumlocation not on record	4
Natural History Museum, Londonlocation not on record	3
Mykotektet, National Veterinary Institutelocation not on record	2
Natuurpuntlocation not on record	2
Sion, CH	2
Archäologie und Museum Baselland - Museum.BLlocation not on record	2
Dhaka, BD	2
PRUNlocation not on record	2
Wuzhou, CN	2
Stockholm, SE	1
Gothenburg, SE	1
DFlocation not on record	1
UGRlocation not on record	1
MZLUlocation not on record	1
Ghent, BE	1

43 institutions · 966 of 1 219 vouchered records shown · 253 without an institution code

09Environmental DNA68 detections

Where the DNA of Megachile leachella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found68

Studies independent surveys1

Countries13

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 68 detections have coordinates

Open the map13 countries0

coastal dunes1.4. Temperate Forest | 1. Forest & Woodlandkiwifruit orchard8. Desert | 8.1. Hot Desert

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.1 °C 2.70–24.5

Seasonal swing summer↔winter15.3 °C

Max temp (day)20.4 °C 6.90–29.1

Min temp (night)13.9 °C -2.60–19.4

Precipitation57.0 mm/mo 3.00–109

Air humidity60.0 % 50.6–63.9

Moisture balance-68.5 mm/mo -183–33.6

Vapour deficit753 Pa 331–1,348

Wind speed3.80 m/s 1.60–4.20

Cloud cover36.6 % 8.10–49.2

CHELSA 1981–2010, ~9 km grid, at location & month of 51 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Megachile leachella

At a glance

Sources9 archives

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type4 368 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions18 of 43 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type4 368 records