Mecaphesa dubia

(Keyserling, 1880) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Thomisidae/Mecaphesa

At a glance

Occurrence records804

Data sources8

Biological traits0

DNA specimens18

eDNA detections20

Sources8 archives

Databases and archives Mecaphesa dubia's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility804 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI20 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics18 specimens↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF804 records

Environmental DNA1 datasets · 3 countries20 detections

DNA & barcodingBOLD18 specimens

01Narrative

Mecaphesa dubia is a species of crab spider in the family Thomisidae. It is found in the United States and Mexico.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding18 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Mecaphesa dubia has left across the world's sequence archives.

At a glance

DNA specimens18

BINs1

Marker genes1

eDNA detections20

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus18 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 33 variable positions, in barcode order

4Tmostly conserved

25Gmostly conserved

43Gmostly conserved

52Amostly conserved

79Amostly conserved

88Amostly conserved

115Tmostly conserved

163Avariable

190Avariable

205Tmostly conserved

229Amostly conserved

235Cmostly conserved

251Cmostly conserved

253Amostly conserved

265Amostly conserved

268Tmostly conserved

271Gmostly conserved

295Amostly conserved

322Amostly conserved

349Amostly conserved

355Tmostly conserved

364Gvariable

382Gmostly conserved

418Tvariable

433Gmostly conserved

466Gmostly conserved

481Amostly conserved

493Gmostly conserved

518Tmostly conserved

583Gvariable

586Tmostly conserved

616Cmostly conserved

625Amostly conserved

AACTTTGTATTTACTATTTGGGGCGTGATCTGCTATAGTTGGGACTGCTATAAGAGTGTTGATTCGAATGGAGTTAGGAAATTCTGGAAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.95%

Haplotypes6

BIN1

Most divergent pair1.4%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Mecaphesa asperatasame genus1.5%Mecaphesa celersame genus2.6%Mecaphesa carletonicasame genus4.3%Mecaphesa californicasame genus4.3%Mecaphesa sierrensissame genus4.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type804 records

Wild obs. + sensor776

Museum / vouchered28

Range

Area of Occupancy AOO2 248 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 438≤1 km 74≤10 km 16>10 km 109

637 georeferenced · 139 without coordinates

Open the mapobservation + sensor776

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy17% within 1 km

≤1 km 1≤10 km 5

6 georeferenced · 22 without coordinates

Open the institutions mapphysical evidence28

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Denver, US	16
Albuquerque, US	5
Chicago, US	2
US	2
San Francisco, US	1
La Paz, MX	1
Frankfurt am Main	1

7 institutions · 28 of 28 vouchered records shown

09Environmental DNA20 detections

Where the DNA of Mecaphesa dubia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found20

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 20 detections have coordinates

Open the map3 countries0

1. Forest & Woodland|1.9. Subtropical/Tropic…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median28.2 °C 25.2–30.1

Seasonal swing summer↔winter14.0 °C

Max temp (day)32.9 °C 29.0–36.1

Min temp (night)24.8 °C 21.0–25.5

Precipitation48.7 mm/mo 15.0–115

Air humidity58.4 % 57.5–61.2

Moisture balance-131 mm/mo -167–-57.0

Vapour deficit1,484 Pa 1,282–1,811

Wind speed2.70 m/s 2.20–4.40

Cloud cover21.9 % 17.8–22.8

CHELSA 1981–2010, ~9 km grid, at location & month of 20 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)