Mecaphesa carletonica

(Dondale & Redner, 1976) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Thomisidae/Mecaphesa

At a glance

Occurrence records33

Data sources8

Biological traits3

DNA specimens51

eDNA detections62

Sources8 archives

Databases and archives Mecaphesa carletonica's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility33 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI62 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics51 specimens↗

World Spider Trait DBMasaryk University3 traits · 1 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources3 traits

Occurrence & distributionGBIF33 records

Environmental DNA1 datasets · 3 countries62 detections

DNA & barcodingBOLD51 specimens

01Narrative

Mecaphesa carletonica is a species of crab spider in the family Thomisidae. It is found in the United States and Canada.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesDondale & Redner 1978

Morphometry3

Body length♀4.36·♂3.2 mm

Cephalothorax length2.08 mm

Cephalothorax width2.06 mm

05DNA & barcoding51 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Mecaphesa carletonica has left across the world's sequence archives.

At a glance

DNA specimens51

BINs9

Marker genes1

eDNA detections62

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus50 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 22 variable positions, in barcode order

22Gmostly conserved

67Amostly conserved

163Gmostly conserved

190Amostly conserved

211Gmostly conserved

229Amostly conserved

250Cmostly conserved

265Avariable

271Amostly conserved

286Avariable

340Cmostly conserved

364Tvariable

367Tvariable

373Amostly conserved

424Cmostly conserved

475Avariable

487Gmostly conserved

502Avariable

535Amostly conserved

541Gmostly conserved

578Cvariable

631Amostly conserved

AACTTTGTATTTATTATTTGGGGCATGATCTGCTATAGTTGGAACTGCTATAAGAGTTTTGATTCGAATGGAGTTAGGAAATTCTGGGAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.8%

Haplotypes21

BINs9

Most divergent pair4.3%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Mecaphesa sierrensissame genus3.0%Mecaphesa dubiasame genus4.3%Mecaphesa asperatasame genus4.7%Mecaphesa californicasame genus4.7%Mecaphesa celersame genus5.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type33 records

Wild obs. + sensor16

Museum / vouchered17

Range

Area of Occupancy AOO108 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 6≤1 km 5>10 km 2

13 georeferenced · 3 without coordinates

Open the mapobservation + sensor16

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

>10 km 1

1 georeferenced · 16 without coordinates

Open the institutions mapphysical evidence17

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Guelph, Centre for Biodiversity Genomicslocation not on record	5
Cambridge, US	2
Chicago, US	2
Denver, US	1
Royal Ontario Museumlocation not on record	1

5 institutions · 11 of 17 vouchered records shown · 6 without an institution code

09Environmental DNA62 detections

Where the DNA of Mecaphesa carletonica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found62

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 62 detections have coordinates

Open the map3 countries0

freshwater stream, and mediterranean climate…1. Forest & Woodland | 1.4. Temperate Forest5. Wetlands (inland)14. Artificial - Terrestrial|14.5 Urban AreasForest4. Native Grassland | 4.4. Temperate Grassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.7 °C 13.0–27.2

Seasonal swing summer↔winter17.9 °C

Max temp (day)27.5 °C 20.1–36.7

Min temp (night)14.5 °C 5.70–18.7

Precipitation14.5 mm/mo 0.2–48.7

Air humidity47.1 % 44.4–60.8

Moisture balance-143 mm/mo -200–-66.3

Vapour deficit1,097 Pa 741–1,957

Wind speed2.50 m/s 1.70–3.70

Cloud cover13.3 % 11.5–38.6

CHELSA 1981–2010, ~9 km grid, at location & month of 61 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)