Massagris honesta — The Life Data

Animalia/Arthropoda/Arachnida/Araneae/Salticidae/Massagris

At a glance

Occurrence records13

Data sources7

Biological traits7

DNA specimens4

eDNA detections0

Sources7 archives

Databases and archives Massagris honesta's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility13 records↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

World Spider Trait DBMasaryk University7 traits · 3 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources7 traits

Occurrence & distributionGBIF13 records

DNA & barcodingBOLD4 specimens

01Narrative

Massagris honesta is a jumping spider species in the genus Massagris that lives in South Africa. It was first identified by Wanda Wesołowska in 1993.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWolff et al. 2022Wesolowska & Haddad 2013Wesolowska 1993

Morphometry3

Abdomen length3.3 mm

Body length6 mm

Cephalothorax length2.7 mm

Predation2

Hunting guild 2ground runner

Web buildingno

Biomechanics1

'Primary mode of locomotionwalking

Morphology1

Cribellumabsent

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Massagris honesta has left across the world's sequence archives.

At a glance

DNA specimens4

BINs1

Marker genes1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.23%

Haplotypes2

BIN1

Most divergent pair0.46%

Where individuals differ — all 3 variable positions, in barcode order

166Amostly conserved

263Tmostly conserved

295Cmostly conserved

AACTTTATATTTAATTTTTGGAGCTTGAGCTGCTATGGTAGGTACGGCAATAAGTGTTTTAATTCGAATAGAATTAGGACAAATTGGAAG …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Icius hamatussame family12.4%Anyphaena apertasame order12.5%Antillattus cambridgeisame family13.1%Wulfila pulverulentussame order13.4%Anyphaena accentuatasame order13.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

COI-5P

animal barcode

08Occurrence & distribution

Record type13 records

Wild obs. + sensor3

Museum / vouchered10

Range

Area of Occupancy AOO44 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 3

3 georeferenced

Open the mapobservation + sensor3

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 10 records without

Open the institutions mapphysical evidence10

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cape Town, ZA	8
Departamento de Geologia, Universidad de Chilelocation not on record	1

2 institutions · 9 of 10 vouchered records shown · 1 without an institution code