Magnoteuthis magna

(Joubin, 1913) · species

image placeholder — illustration coming later

Animalia/Mollusca/Cephalopoda/Oegopsida/Mastigoteuthidae/Magnoteuthis

At a glance

Occurrence records387

Data sources8

Biological traits6

DNA specimens19

eDNA detections14

Sources8 archives

Databases and archives Magnoteuthis magna's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility143 records↗

OBISOcean Biodiversity Information System244 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI14 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics19 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources6 traits

Occurrence & distributionGBIF · OBIS387 records

Environmental DNA2 datasets · 2 countries14 detections

DNA & barcodingBOLD19 specimens

01Narrative

Mastigoteuthis magna is a species of whip-lash squid, characterised by a lack of photophores. The skin is heavily pigmented a deep red by a numerous chromatophores. Side view of a club sucker Funnel component of the [[Funnel–mantle locking apparatus|funnel locking apparatus]] Mastigoteuthis magna.jpg| ''M. magna''

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Size & morphology1

Body length16 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonepelagic-oceanic

Uses & economy1

Commercial importanceof no interest

Other traits2

Depth max1 500 m

Depth min200 m

05DNA & barcoding19 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Magnoteuthis magna has left across the world's sequence archives.

At a glance

DNA specimens19

BINs1

Marker genes4

eDNA detections14

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P647 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 92% of positions are identical in every specimen.

Diversity (π)2.0%

Haplotypes1

BIN1

Where individuals differ — all 52 variable positions, in barcode order

1Tmostly conserved

2Gmostly conserved

5Cmostly conserved

6Amostly conserved

7Gmostly conserved

8Gmostly conserved

9Gmostly conserved

13Tmostly conserved

14Tmostly conserved

16Gmostly conserved

17Gmostly conserved

18Amostly conserved

19Amostly conserved

21Cmostly conserved

23Cmostly conserved

24Tmostly conserved

25Tmostly conserved

26Tmostly conserved

28Amostly conserved

29Gmostly conserved

31Tmostly conserved

36Amostly conserved

37Amostly conserved

38Tmostly conserved

40Cmostly conserved

41Gmostly conserved

42Tmostly conserved

43Amostly conserved

44Cmostly conserved

45Cmostly conserved

46Gmostly conserved

47Amostly conserved

49Cmostly conserved

50Tmostly conserved

52Gmostly conserved

53Gmostly conserved

56Amostly conserved

57Amostly conserved

58Cmostly conserved

59Cmostly conserved

60Tmostly conserved

61Gmostly conserved

62Gmostly conserved

64Tmostly conserved

65Cmostly conserved

66Cmostly conserved

70Cmostly conserved

71Tmostly conserved

72Amostly conserved

73Amostly conserved

75Cmostly conserved

420Cmostly conserved

TGAGCAGGGTTATTAGGAACCTCTTTAAGATTAATAATTCGTACCGAACTAGGACAACCTGGCTCCCTACTAAACGATGATCAATTATAC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Magnoteuthis osheaisame genus9.0%Mastigopsis hjortisame family11.7%Mastigoteuthis agassiziisame family12.1%Mastigoteuthis psychrophilasame family13.1%Idioteuthis cordiformissame family13.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P16S18S-5P12S

animal barcoderibosomalmarker

08Occurrence & distribution

Record type387 records

Wild obs. + sensor105

Museum / vouchered256

Other26

Range

Area of Occupancy AOO868 km²

Depth

0–200 m sunlit56

200–1000 m twilight84

1–4 km midnight79

>4 km abyssal0

median 665.6 m · max 3 321.5 m · 219 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤1 km 8

8 georeferenced · 97 without coordinates

Open the mapobservation + sensor105

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy78% within 1 km

≤1 km 7≤10 km 1>10 km 1

9 georeferenced · 247 without coordinates

Open the institutions mapphysical evidence256

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
The Atlantic reference Centrelocation not on record	49
Delaware Museum of Nature and Sciencelocation not on record	24
Washington, US	3
Museums Victorialocation not on record	2
Australian National Fish Collectionlocation not on record	2
IEOlocation not on record	2
Cambridge, US	1
UAclocation not on record	1
Tasmanian Museum & Art Gallerylocation not on record	1

9 institutions · 85 of 256 vouchered records shown · 1 without an institution code

09Environmental DNA14 detections

Where the DNA of Magnoteuthis magna was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found14

Studies independent surveys2

Countries2

Verifiable raw sequence linked1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 14 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.5 °C 18.4–18.6

Seasonal swing summer↔winter12.6 °C

Max temp (day)19.4 °C 19.2–19.5

Min temp (night)17.8 °C 17.7–17.9

Precipitation78.8 mm/mo 50.9–107

Air humidity67.6 % 65.7–69.5

Vapour deficit691 Pa 656–726

Cloud cover43.0 % 40.2–45.8

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)