Idioteuthis cordiformis

(Chun, 1908) · species

image placeholder — illustration coming later

Animalia/Mollusca/Cephalopoda/Oegopsida/Mastigoteuthidae/Idioteuthis

At a glance

Occurrence records248

Data sources7

Biological traits2

DNA specimens12

eDNA detections0

Sources7 archives

Databases and archives Idioteuthis cordiformis's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility123 records↗

OBISOcean Biodiversity Information System125 records↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF · OBIS248 records

DNA & barcodingBOLD12 specimens

01Narrative

Idioteuthis cordiformis is a species of whip-lash squid found in tropical regions of the west Pacific Ocean. The species is commonly known as the 'love-heart squid' because the species name cordiformis is Latin for 'heart shaped'. Recently, this species has been found to consume small birdbeak dogfish.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonedemersal

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Idioteuthis cordiformis has left across the world's sequence archives.

At a glance

DNA specimens12

BINs1

Marker genes3

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.00%

Haplotypes1

BIN1

CACACTGTATTTTATTTTTGGCATCTGAGCAGGATTACTAGGAACCTCTTTAAGCTTAATAATTCGTACTGAATTAGGTCAGCCTGGGTC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Mastigoteuthis agassiziisame family13.7%Magnoteuthis magnasame family13.7%Mastigopsis hjortisame family14.6%Mastigoteuthis psychrophilasame family14.9%Magnoteuthis osheaisame family15.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P16S12S

animal barcoderibosomalmarker

08Occurrence & distribution

Record type248 records

Wild obs. + sensor27

Museum / vouchered219

Other2

Range

Area of Occupancy AOO444 km²

Depth

0–200 m sunlit0

200–1000 m twilight43

1–4 km midnight25

>4 km abyssal0

median 926.8 m · max 1 590 m · 68 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 2≤1 km 18>10 km 3

23 georeferenced · 4 without coordinates

Open the mapobservation + sensor27

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy64% within 1 km

≤1 km 58≤10 km 29>10 km 4

91 georeferenced · 128 without coordinates

Open the institutions mapphysical evidence219

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museums Victorialocation not on record	29
Earth Sciences New Zealandlocation not on record	25
Wellington, NZ	13
Australian National Fish Collectionlocation not on record	12
Western Australian Museumlocation not on record	11
Paris, FR	9
Sydney, AU	6
Tasmanian Museum & Art Gallerylocation not on record	3
Museum and Art Gallery of the Northern Territorylocation not on record	1

9 institutions · 109 of 219 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)