Madoryx pseudothyreus

Grote, 1865 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Sphingidae/Madoryx

At a glance

Occurrence records88

Data sources7

Biological traits0

DNA specimens5

eDNA detections5

Sources7 archives

Databases and archives Madoryx pseudothyreus's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility88 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF88 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingBOLD5 specimens

01Narrative

Madoryx pseudothyreus, the false-windowed sphinx, is a moth of the family Sphingidae. The species was first described by Augustus Radcliffe Grote in 1865. It is known from the tip of Florida down to Cuba and the surrounding West Indies. The wingspan is 66–70 mm. There is a small olive-green basal patch on the forewing upperside which is separated into two spots. There is a brown marginal band on the forewing underside. There are multiple generations per year. Adults feed on the nectar of various flowers, including Asystasia gangetica. The larvae have been recorded feeding on Avicennia germinans. Pupation takes place in cocoons spun amongst leaf litter.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Madoryx pseudothyreus has left across the world's sequence archives.

At a glance

DNA specimens5

BINs1

Marker genes1

eDNA detections5

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 14 variable positions, in barcode order

40Gmostly conserved

79Amostly conserved

100Avariable

160Gmostly conserved

181Gmostly conserved

202Amostly conserved

313Cmostly conserved

349Tvariable

466Gmostly conserved

550Cmostly conserved

577Amostly conserved

616Cmostly conserved

634Cvariable

646Cmostly conserved

AACATTATATTTTATTTTTGGTATTTGAGCAGGAATAGTGGGAACTTCATTAAGATTATTAATTCGAGCAGAATTGGGAAATCCTGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.94%

Haplotypes4

BIN1

Most divergent pair1.4%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Madoryx bubastussame genus5.6%Proserpinus proserpinasame family7.4%Amphion floridensissame family7.9%Rethera komarovisame family8.1%Callionima julianesame family8.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type88 records

Wild obs. + sensor63

Museum / vouchered25

Range

Area of Occupancy AOO184 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 35≤1 km 10≤10 km 4>10 km 7

56 georeferenced · 7 without coordinates

Open the mapobservation + sensor63

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy38% within 1 km

≤1 km 8≤10 km 12>10 km 1

21 georeferenced · 4 without coordinates

Open the institutions mapphysical evidence25

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
New Haven, US	13
RBINS-Scientific Heritagelocation not on record	4
Brussels, BE	4
Cleveland Museum of Natural History, OH (CLEV)location not on record	3

4 institutions · 24 of 25 vouchered records shown · 1 without an institution code

09Environmental DNA5 detections

Where the DNA of Madoryx pseudothyreus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median27.5 °C 27.5–27.8

Seasonal swing summer↔winter4.50 °C

Max temp (day)28.6 °C 28.6–29.1

Min temp (night)26.5 °C 26.5–26.7

Precipitation182 mm/mo 146–182

Air humidity64.3 % 63.7–64.3

Vapour deficit1,305 Pa 1,305–1,356

Cloud cover29.6 % 29.6–35.2

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)