Madoryx bubastus

Cramer, 1777 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Sphingidae/Madoryx

At a glance

Occurrence records68

Data sources7

Biological traits0

DNA specimens28

eDNA detections28

Sources7 archives

Databases and archives Madoryx bubastus's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility68 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI28 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics28 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF68 records

Environmental DNA1 datasets · 8 countries28 detections

DNA & barcodingBOLD28 specimens

01Narrative

Madoryx bubastus is a moth of the family Sphingidae. It is found in Central America (including Costa Rica and Guatemala) and South America, including French Guiana and Venezuela south to at least Bolivia and Argentina. It is also present in Mexico. The wingspan is 92–120 mm. The upperside of the body and wings are olive-brown. There is a small, rounded or ovate, upper silver discal spot on the forewing upperside. Adults are probably on wing year round. The larvae have been recorded feeding on Guettarda macrosperma. Pupation takes place in a flimsy cocoon amongst leaf litter.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding28 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Madoryx bubastus has left across the world's sequence archives.

At a glance

DNA specimens28

BINs3

Marker genes1

eDNA detections28

Countries8

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus24 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 28 variable positions, in barcode order

7Gvariable

31Amostly conserved

91Cvariable

112Tvariable

136Tvariable

169Tmostly conserved

211Avariable

232Tmostly conserved

238Avariable

250Tvariable

304Tvariable

361Cvariable

364Tvariable

400Cvariable

421Tvariable

439Tvariable

460Cvariable

463Tmostly conserved

470Avariable

478Tvariable

490Tvariable

526Avariable

532Tvariable

542Cvariable

574Tvariable

595Tvariable

640Cvariable

646Cvariable

TACATTGTATTTTATTTTTGGTATTTGAGCAGGAATAGTAGGAACTTCTTTAAGATTACTAATTCGAGCAGAATTAGGAAATCCTGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.0%

Haplotypes8

BINs3

Most divergent pair4.0%

S.AmericaN.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Madoryx pseudothyreussame genus5.6%Rethera komarovisame family7.6%Sphingonaepiopsis gorgoniadessame family7.6%Sphecodina abbottiisame family8.1%Enyo gorgonsame family8.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type68 records

Wild obs. + sensor36

Museum / vouchered32

Range

Area of Occupancy AOO212 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy76% within 1 km

≤100 m 18≤1 km 4≤10 km 4>10 km 3

29 georeferenced · 7 without coordinates

Open the mapobservation + sensor36

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 4

4 georeferenced · 28 without coordinates

Open the institutions mapphysical evidence32

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
National Biodiversity Institute, Costa Ricalocation not on record	25
New Haven, US	3
University of Pennsylvanialocation not on record	2
Natural History Museum Rotterdamlocation not on record	1

4 institutions · 31 of 32 vouchered records shown · 1 without an institution code

09Environmental DNA28 detections

Where the DNA of Madoryx bubastus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found28

Studies independent surveys1

Countries8

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 28 detections have coordinates

Open the map8 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.2 °C 22.3–26.2

Seasonal swing summer↔winter2.30 °C

Max temp (day)29.8 °C 26.2–30.2

Min temp (night)21.9 °C 18.8–23.2

Precipitation203 mm/mo 79.4–384

Air humidity66.5 % 62.2–71.2

Moisture balance27.4 mm/mo -57.2–256

Vapour deficit1,096 Pa 731–1,191

Wind speed1.40 m/s 0.8–1.90

Cloud cover37.3 % 24.8–57.6

CHELSA 1981–2010, ~9 km grid, at location & month of 27 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)