Maculinea teleius

(Bergstrasser, 1779) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Lycaenidae/Maculinea

At a glance

Occurrence records4 599

Data sources5

Biological traits0

DNA specimens13

eDNA detections227

Sources5 archives

Databases and archives Maculinea teleius's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 599 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI227 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF4 599 records

Environmental DNA1 datasets · 20 countries227 detections

DNA & barcodingBOLD13 specimens

01Narrative

L’Azuré de la sanguisorbe ou Argus strié ou Télégone est une espèce de lépidoptère (papillon) de la famille des Lycaenidae, de la sous-famille des Polyommatinae et du genre Phengaris.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Maculinea teleius has left across the world's sequence archives.

At a glance

DNA specimens13

BINs2

Marker genes1

eDNA detections227

Countries20

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Diversity (π)1.1%

Haplotypes2

BINs2

Most divergent pair2.0%

Where individuals differ — all 13 variable positions, in barcode order

50Tvariable

85Avariable

88Gvariable

118Cvariable

208Gvariable

212Tvariable

220Tvariable

535Avariable

539Tvariable

550Avariable

565Avariable

616Tvariable

646Cvariable

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATATTAGGAATATCTTTAAGAATTTTAATTCGAATAGAATTAGGAACTCCAGGGTC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Maculinea arionsame genus1.8%Phengaris atroguttatasame family4.7%Glaucopsyche piasussame family5.2%Glaucopsyche lycormassame family5.2%Philotes sonorensissame family5.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type4 599 records

Wild obs. + sensor3 429

Museum / vouchered949

Other221

Range

Area of Occupancy AOO4 400 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy15% within 1 km

≤100 m 413≤1 km 81≤10 km 2 863>10 km 18

3 375 georeferenced · 54 without coordinates

Open the mapobservation + sensor3 429

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy87% within 1 km

≤100 m 4≤1 km 482≤10 km 64>10 km 9

559 georeferenced · 390 without coordinates

Open the institutions mapphysical evidence949

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Provincia di Livornolocation not on record	366
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	242
Zürich, CH	115
Podgorica, ME	60
Uniwersytet Marii Curie-Skłodowskiejlocation not on record	51
Uniwersytet Łódzkilocation not on record	27
Adam Mickiewicz University in Poznańlocation not on record	18
John May Museum of Natural Historylocation not on record	12
Natural History Museum of Utahlocation not on record	12
Laboratorium voor Microbiologie der Landbouwhogeschoollocation not on record	11
University of Kaiserslauternlocation not on record	7
Toyota city nature sanctuarylocation not on record	6
Iwate Prefectural Museumlocation not on record	4
Sanda, JP	4
New Haven, US	3

15 institutions · 938 of 949 vouchered records shown · 8 without an institution code

09Environmental DNA227 detections

Where the DNA of Maculinea teleius was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found227

Studies independent surveys1

Countries20

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 227 detections have coordinates

Open the map20 countries0

WET GRASSLAND

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.7 °C 11.1–22.0

Seasonal swing summer↔winter22.3 °C

Max temp (day)23.2 °C 14.8–26.5

Min temp (night)14.0 °C 5.80–16.9

Precipitation85.4 mm/mo 58.5–149

Air humidity60.0 % 55.3–63.7

Moisture balance-34.3 mm/mo -62.4–37.9

Vapour deficit879 Pa 508–1,134

Wind speed2.50 m/s 1.80–3.50

Cloud cover36.1 % 33.1–46.0

CHELSA 1981–2010, ~9 km grid, at location & month of 216 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Maculinea teleius

At a glance

Sources5 archives

At a glance

Record type4 599 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions4 of 15 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type4 599 records