Maculinea arion

(Linnaeus, 1758) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Lycaenidae/Maculinea

At a glance

Occurrence records28 947

Data sources7

Biological traits2

DNA specimens17

eDNA detections174

Sources7 archives

Databases and archives Maculinea arion's data was compiled from.

WikipediaWikimedia Foundation10 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility28 947 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI174 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics17 specimens↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF28 947 records

Environmental DNA1 datasets · 23 countries174 detections

DNA & barcodingBOLD17 specimens

Genome at a glanceNCBI≈544 Mbp

01Narrative

The large blue (Phengaris arion) is a species of butterfly in the family Lycaenidae. The species was first defined in 1758 and first recorded in Britain in 1795. In 1979 the species became mostly extinct in Britain but has been successfully reintroduced with new conservation methods. The species is classified as "near threatened" on the IUCN Red List of Threatened Species. Today P. arion can be found in Europe, the Caucasus, Armenia, western Siberia, Altai, north-western Kazakhstan and Sichuan. The large blue can be distinguished by its unique speckled black dots on its wings with a blue background. The large blue butterfly is well known in behavioural ecology as it is a brood parasite of a single species of red ant, Myrmica sabuleti.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)brood parasite

05DNA & barcoding17 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Maculinea arion has left across the world's sequence archives.

At a glance

DNA specimens17

BINs1

Marker genes1

eDNA detections174

Countries23

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 89% of positions are identical in every specimen.

Diversity (π)4.3%

Haplotypes2

BIN1

Most divergent pair0.15%

Where individuals differ — all 72 variable positions, in barcode order

2Amostly conserved

3Cmostly conserved

6Tmostly conserved

7Amostly conserved

9Amostly conserved

11Tmostly conserved

14Amostly conserved

17Tmostly conserved

18Tmostly conserved

19Tmostly conserved

20Gmostly conserved

21Gmostly conserved

22Amostly conserved

23Amostly conserved

24Tmostly conserved

25Tmostly conserved

26Tmostly conserved

27Gmostly conserved

30Cmostly conserved

32Gmostly conserved

33Gmostly conserved

35Amostly conserved

38Tmostly conserved

39Tmostly conserved

41Gmostly conserved

42Gmostly conserved

44Amostly conserved

45Tmostly conserved

46Amostly conserved

48Cmostly conserved

49Tmostly conserved

50Tmostly conserved

51Tmostly conserved

54Gmostly conserved

55Amostly conserved

56Amostly conserved

58Tmostly conserved

59Tmostly conserved

61Amostly conserved

62Amostly conserved

63Tmostly conserved

64Tmostly conserved

65Cmostly conserved

66Gmostly conserved

68Amostly conserved

69Tmostly conserved

71Gmostly conserved

72Amostly conserved

74Tmostly conserved

75Tmostly conserved

77Gmostly conserved

78Gmostly conserved

79Amostly conserved

80Amostly conserved

82Tmostly conserved

83Cmostly conserved

84Cmostly conserved

86Gmostly conserved

87Gmostly conserved

88Amostly conserved

90Cmostly conserved

91Tmostly conserved

92Tmostly conserved

94Amostly conserved

95Amostly conserved

96Tmostly conserved

97Tmostly conserved

98Gmostly conserved

99Gmostly conserved

100Amostly conserved

235Tmostly conserved

595Tmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATATTAGGAATATCTTTAAGAATTTTAATTCGAATAGAATTAGGAACTCCAGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Maculinea teleiussame genus1.8%Glaucopsyche piasussame family3.6%Philotes sonorensissame family4.0%Glaucopsyche alexissame family4.1%Phengaris atroguttatasame family4.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceNCBI

The complete instruction manual Maculinea arion carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈544 489 716 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Maculinea arion0.54 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

08Occurrence & distribution

Record type28 947 records

Wild obs. + sensor26 907

Museum / vouchered1 441

Cultivated / captive19

Other580

Range

Area of Occupancy AOO22 480 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy64% within 1 km

≤100 m 14 058≤1 km 2 163≤10 km 9 033>10 km 274

25 528 georeferenced · 1 379 without coordinates

Open the mapobservation + sensor26 907

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy76% within 1 km

≤100 m 20≤1 km 689≤10 km 187>10 km 42

938 georeferenced · 503 without coordinates

Open the institutions mapphysical evidence1 441

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 19 records without

Open the mapnot free-living19

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Provincia di Livornolocation not on record	589
Zürich, CH	275
South Kensington, GB	242
Laboratorium voor Microbiologie der Landbouwhogeschoollocation not on record	49
Edmonton, CA	35
Uniwersytet Łódzkilocation not on record	35
SLU Artdatabankenlocation not on record	30
New Haven, US	29
Durban Natural Science Museumlocation not on record	26
Nijmegen, NL	25
Adam Mickiewicz University in Poznańlocation not on record	25
John May Museum of Natural Historylocation not on record	16
University of Kaiserslauternlocation not on record	14
Uniwersytet Marii Curie-Skłodowskiejlocation not on record	11
Philadelphia, US	4
European Distributed Institute of Taxonomy (EDIT)location not on record	3
Sanda, JP	3
Cleveland Museum of Natural History, OH (CLEV)location not on record	3
Stockholm, SE	2

19 institutions · 1 416 of 1 441 vouchered records shown · 20 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA174 detections

Where the DNA of Maculinea arion was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found174

Studies independent surveys1

Countries23

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 174 detections have coordinates

Open the map23 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.0 °C 3.50–20.8

Seasonal swing summer↔winter20.5 °C

Max temp (day)18.2 °C 6.80–24.9

Min temp (night)8.80 °C -1.80–15.2

Precipitation70.3 mm/mo 44.0–175

Air humidity59.8 % 54.8–63.7

Moisture balance-30.4 mm/mo -95.1–82.8

Vapour deficit673 Pa 362–1,041

Wind speed2.60 m/s 1.80–5.20

Cloud cover37.7 % 33.3–48.6

CHELSA 1981–2010, ~9 km grid, at location & month of 148 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Maculinea arion

At a glance

Sources7 archives

Diet & foraging2

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type28 947 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions8 of 19 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type28 947 records