Maculabatis pastinacoides

(Bleeker, 1852) · species

image placeholder — illustration coming later

Animalia/Chordata/Elasmobranchii/Myliobatiformes/Dasyatidae/Maculabatis

At a glance

Occurrence records32

Data sources9

Biological traits4

DNA specimens29

eDNA detections7

Sources9 archives

Databases and archives Maculabatis pastinacoides's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility26 records↗

OBISOcean Biodiversity Information System6 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics29 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF · OBIS32 records

Environmental DNA1 datasets · 1 countries7 detections

DNA & barcodingBOLD29 specimens

01Narrative

The round whipray (Maculabatis pastinacoides) is a species of stingray in the family Dasyatidae. It is found in the Indo-Malay Archipelago including Java, Sumatra and Borneo. This species reaches a length of 28 cm.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length80 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonedemersal

Other traits1

Vulnerability90

05DNA & barcoding29 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Maculabatis pastinacoides has left across the world's sequence archives.

At a glance

DNA specimens29

BINs2

Marker genes3

eDNA detections7

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P650 bp consensus21 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 18 variable positions, in barcode order

2Cmostly conserved

7Cmostly conserved

79Cvariable

83Cvariable

148Tvariable

187Gvariable

214Gvariable

217Tvariable

244Avariable

346Cvariable

370Amostly conserved

392Tvariable

451Cvariable

520Cvariable

523Avariable

547Cvariable

643Cmostly conserved

646Tvariable

TCTTATCTTCGGTGCATGAGCAGGGATAGTGGGCACTGGTCTTAGCCTCCTCATTCGAACAGAGTTAAGCCAACCAGGCGCACTACTCGG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.2%

Haplotypes3

BINs2

Most divergent pair2.3%

Asia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Maculabatis arabicasame genus8.0%Maculabatis macrurasame genus8.9%Maculabatis gerrardisame genus9.0%Maculabatis astrasame genus9.6%Maculabatis toshisame genus9.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P16SND2

animal barcoderibosomalmitochondrial

08Occurrence & distribution

Record type32 records

Wild obs. + sensor9

Museum / vouchered23

Range

Area of Occupancy AOO68 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 6

6 georeferenced · 3 without coordinates

Open the mapobservation + sensor9

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 23 records without

Open the institutions mapphysical evidence23

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
University of Dhaka, Department of Zoologylocation not on record	4
FishBaselocation not on record	1

2 institutions · 5 of 23 vouchered records shown · 15 without an institution code

09Environmental DNA7 detections

Where the DNA of Maculabatis pastinacoides was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.8 °C 25.0–27.4

Seasonal swing summer↔winter6.30 °C

Max temp (day)27.8 °C 26.9–28.1

Min temp (night)26.0 °C 22.5–26.5

Precipitation266 mm/mo 67.0–441

Air humidity64.2 % 59.8–66.6

Vapour deficit1,208 Pa 1,189–1,333

Cloud cover40.9 % 24.4–57.3

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)