Maculabatis gerrardi

(Gray, 1851) · species

image placeholder — illustration coming later

Animalia/Chordata/Elasmobranchii/Myliobatiformes/Dasyatidae/Maculabatis

At a glance

Occurrence records383

Data sources10

Biological traits7

DNA specimens49

eDNA detections9

Sources10 archives

Databases and archives Maculabatis gerrardi's data was compiled from.

WikipediaWikimedia Foundation8 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility304 records↗

OBISOcean Biodiversity Information System79 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics49 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources7 traits

Occurrence & distributionGBIF · OBIS383 records

Environmental DNA1 datasets · 3 countries9 detections

DNA & barcodingBOLD49 specimens

01Narrative

The whitespotted whipray or sharpnose stingray (Maculabatis gerrardi) is a species of stingray in the family Dasyatidae. It is found in coastal regions including estuaries, in the Indo-Pacific, and has also been recorded in the Ganges River. It reaches a maximum length of 2 metres (6½ ft). As presently defined, it is probably a species complex.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length200 cm

Habitat & environment3

Habitat brackishyes

Habitat saltwateryes

Habitat zonedemersal

Uses & economy1

Commercial importancecommercial

Other traits2

Depth max50 m

Vulnerability90

05DNA & barcoding49 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Maculabatis gerrardi has left across the world's sequence archives.

At a glance

DNA specimens49

BINs2

Marker genes3

eDNA detections9

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus43 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 31 variable positions, in barcode order

29Cmostly conserved

65Cmostly conserved

74Tmostly conserved

104Cmostly conserved

143Cmostly conserved

146Amostly conserved

152Gmostly conserved

158Cmostly conserved

167Amostly conserved

185Cmostly conserved

192Cmostly conserved

194Amostly conserved

221Tmostly conserved

296Gmostly conserved

326Cmostly conserved

344Cmostly conserved

350Amostly conserved

374Gmostly conserved

389Amostly conserved

407Tmostly conserved

416Avariable

434Cmostly conserved

446Cmostly conserved

449Cmostly conserved

506Cmostly conserved

515Tmostly conserved

614Amostly conserved

617Tmostly conserved

623Amostly conserved

638Cmostly conserved

653Tmostly conserved

TCTTCGGTGCATGAGCAGGGATAGTGGGCACTGGTCTTAGTCTGCTCATTCGAACAGAGCTAAGCCAACCAGGTGCACTACTAGGTGATG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.6%

Haplotypes3

BINs2

Most divergent pair0.31%

Asia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Maculabatis macrurasame genus4.0%Maculabatis astrasame genus8.6%Maculabatis toshisame genus8.6%Maculabatis pastinacoidessame genus9.0%Maculabatis arabicasame genus9.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P16SND2

animal barcoderibosomalmitochondrial

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_026208 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND1ND2COX1COX2ATP8ATP6COX3ND3ND4LND4ND5ND6CYTB12S ribosomal RNA16S ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type383 records

Wild obs. + sensor293

Museum / vouchered89

Other1

Range

Area of Occupancy AOO508 km²

Depth

0–200 m sunlit20

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 28.2 m · max 60 m · 20 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 46

46 georeferenced · 247 without coordinates

Open the mapobservation + sensor293

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy18% within 1 km

≤100 m 1≤1 km 2≤10 km 4>10 km 10

17 georeferenced · 72 without coordinates

Open the institutions mapphysical evidence89

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Frankfurt am Main	4
University of Dhaka, Department of Zoologylocation not on record	3
South African Institute for Aquatic Biodiversitylocation not on record	3
Cambridge, US	2
Wuzhou, CN	2
Mutare Museumlocation not on record	1
FishBaselocation not on record	1
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1

8 institutions · 17 of 89 vouchered records shown · 22 without an institution code

09Environmental DNA9 detections

Where the DNA of Maculabatis gerrardi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.8 °C 18.9–27.0

Seasonal swing summer↔winter6.30 °C

Max temp (day)25.4 °C 22.0–28.5

Min temp (night)24.0 °C 14.7–25.5

Precipitation91.0 mm/mo 21.5–328

Air humidity61.9 % 59.0–65.8

Vapour deficit1,218 Pa 751–1,432

Cloud cover29.3 % 13.5–47.8

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)