Macaria granitata

Guenée, 1857 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Geometridae/Macaria

At a glance

Occurrence records1 084

Data sources6

Biological traits0

DNA specimens12

eDNA detections1

Sources6 archives

Databases and archives Macaria granitata's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 084 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 084 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD12 specimens

01Narrative

Macaria granitata, the granite moth, is a moth of the family Geometridae. It is found in Pennsylvania, Maine, New Hampshire, New England, New Jersey, southern Quebec, Ohio, North Carolina, South Carolina and Georgia. The wingspan is about 25 mm. There are one to two generations per year. The larvae mainly feed on Pinus rigida in New England. In southern New Jersey they have been recorded on Pinus rigida and other hard pines.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Macaria granitata has left across the world's sequence archives.

At a glance

DNA specimens12

BINs1

Marker genes1

eDNA detections1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus9 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Diversity (π)0.92%

Haplotypes2

BIN1

Most divergent pair0.15%

Where individuals differ — all 23 variable positions, in barcode order

21Gmostly conserved

22Amostly conserved

23Amostly conserved

24Tmostly conserved

27Gmostly conserved

28Avariable

29Gmostly conserved

30Cmostly conserved

31Amostly conserved

32Gmostly conserved

34Amostly conserved

106Tmostly conserved

118Tmostly conserved

163Amostly conserved

229Gmostly conserved

268Amostly conserved

302Amostly conserved

313Tmostly conserved

352Tmostly conserved

544Amostly conserved

548Tmostly conserved

556Amostly conserved

565Gmostly conserved

AACTTTATATTTTATTTTCGGAATTTGAGCAGGAATAGTAGGAACTTCTTTAAGATTATTAATTCGAGCAGAATTAGGTAACCCCGGCTC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Macaria fissinotatasame genus1.8%Macaria owenisame genus2.1%Macaria bicoloratasame genus5.0%Macaria masqueratasame genus5.3%Macaria lituratasame genus5.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 084 records

Wild obs. + sensor615

Museum / vouchered469

Range

Area of Occupancy AOO1 612 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 267≤1 km 134≤10 km 23>10 km 32

456 georeferenced · 159 without coordinates

Open the mapobservation + sensor615

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy18% within 1 km

≤100 m 9≤1 km 37≤10 km 190>10 km 17

253 georeferenced · 216 without coordinates

Open the institutions mapphysical evidence469

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cambridge, US	116
New Haven, US	74
Mississippi State, US	66
East Lansing, US	57
University of Guelph, Centre for Biodiversity Genomicslocation not on record	31
Colorado State Universitylocation not on record	26
ASUlocation not on record	5
Washington, US	4
Natural History Museum of Utahlocation not on record	3
OSUClocation not on record	3
Cornell University Insect Collectionlocation not on record	3
Chicago, US	2
Toronto, CA	2
St. Paul, US	2
CUlocation not on record	1
Smithsonian Institution, National Museum of Natural Historylocation not on record	1
Blacksburg, US	1

17 institutions · 397 of 469 vouchered records shown · 72 without an institution code

09Environmental DNA1 detections

Where the DNA of Macaria granitata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.2 °C 20.2–20.2

Seasonal swing summer↔winter24.2 °C

Max temp (day)25.1 °C

Min temp (night)16.2 °C

Precipitation107 mm/mo

Air humidity58.1 %

Moisture balance2.40 mm/mo

Vapour deficit994 Pa

Wind speed2.80 m/s

Cloud cover38.5 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Macaria granitata

At a glance

Sources6 archives

At a glance

Record type1 084 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions9 of 17 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 084 records