Macaria fissinotata

Walker · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Geometridae/Macaria

At a glance

Occurrence records639

Data sources5

Biological traits0

DNA specimens12

eDNA detections0

Sources5 archives

Databases and archives Macaria fissinotata's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility639 records↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF639 records

DNA & barcodingBOLD12 specimens

01Narrative

Macaria fissinotata, the hemlock angle, is a moth of the family Geometridae. It is found in North America from Nova Scotia to Georgia, west to Kentucky, north to Ontario. Caterpillar The wingspan is 22–25 mm. The moth flies from May to September and from May to July in Quebec. Its Latin name fissinotata is composed of the Latin word "fissus" (meaning cleaved or split) and "notatus" (mark). This probably refers to the forewing's large spot which is often split into two. The larva feed on Tsuga and Picea species, as well as Abies balsamea.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Macaria fissinotata has left across the world's sequence archives.

At a glance

DNA specimens12

BINs1

Marker genes1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus9 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 19 variable positions, in barcode order

28Gvariable

34Avariable

50Tmostly conserved

106Cvariable

118Cvariable

229Amostly conserved

268Gvariable

286Tmostly conserved

302Gvariable

379Amostly conserved

403Amostly conserved

412Gmostly conserved

478Tvariable

523Tmostly conserved

539Tmostly conserved

556Gvariable

588Amostly conserved

589Cmostly conserved

640Cvariable

AACTTTATATTTTATTTTCGGAATTTGGGCAGGAATAGTAGGAACTTCTTTAAGATTATTAATTCGAGCAGAATTAGGTAACCCCGGCTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.2%

Haplotypes4

BIN1

Most divergent pair2.1%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Macaria unipunctariasame genus1.5%Macaria signariasame genus1.7%Macaria granitatasame genus1.8%Macaria masqueratasame genus5.3%Macaria bisignatasame genus5.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type639 records

Wild obs. + sensor222

Museum / vouchered417

Range

Area of Occupancy AOO1 136 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 104≤1 km 35≤10 km 13>10 km 16

168 georeferenced · 54 without coordinates

Open the mapobservation + sensor222

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy29% within 1 km

≤100 m 31≤1 km 52≤10 km 191>10 km 15

289 georeferenced · 128 without coordinates

Open the institutions mapphysical evidence417

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cambridge, US	202
New Haven, US	105
ASUlocation not on record	38
Colorado State Universitylocation not on record	22
Mississippi State, US	13
Cornell University Insect Collectionlocation not on record	10
East Lansing, US	4
Smithsonian Institution, National Museum of Natural Historylocation not on record	2
Toronto, CA	2
SOVTlocation not on record	2
Philadelphia, US	1
University of Guelph, Centre for Biodiversity Genomicslocation not on record	1
OSUClocation not on record	1
St. Paul, US	1
Blacksburg, US	1

15 institutions · 405 of 417 vouchered records shown · 12 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)