Liagora boergesenii

Yamada, 1938 · species

image placeholder — illustration coming later

Plantae/Rhodophyta/Florideophyceae/Nemaliales/Liagoraceae/Liagora

At a glance

Occurrence records54

Data sources7

Biological traits0

DNA specimens6

eDNA detections2

Sources7 archives

Databases and archives Liagora boergesenii's data was compiled from.

GBIFGlobal Biodiversity Information Facility41 records↗

OBISOcean Biodiversity Information System13 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF · OBIS54 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI6 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Liagora boergesenii has left across the world's sequence archives.

At a glance

DNA specimens6

BINs1

Marker genes2

GenBank sequences3

eDNA detections2

The DNA barcodea real sequence read deposited for this species

rbcLMW275842.1 ↗556 bp

ACGT

GCGACATGGACAGTTGTATGGACAGATCTATTAACTGCTTGTGATTTGTATCGTGCTAAAGCTTACAAAGTAGATGCTGTTCCAAATTCT …

Liagora boergesenii ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; plastid

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Liagora harveyanasame genus11.8%Liagora ceranoidessame genus14.1%Trichogloea herveyisame family15.7%Liagora distentasame genus15.7%Galaxaura rugosasame order17.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★rbcL3

animal barcodeplant barcode

08Occurrence & distribution

Record type54 records

Wild obs. + sensor2

Museum / vouchered43

Other9

Range

Area of Occupancy AOO132 km²

Depth

0–200 m sunlit2

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 0.5 m · max 1 m · 2 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 1 without coordinates

Open the mapobservation + sensor2

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy57% within 1 km

≤100 m 3≤1 km 9≤10 km 6>10 km 3

21 georeferenced · 22 without coordinates

Open the institutions mapphysical evidence43

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Honolulu, US	6
BISHlocation not on record	6
James Cook Townsvillelocation not on record	4
MeiseBGlocation not on record	3
Museo Entomologico de Leonlocation not on record	2
University of Hawaii at Manoalocation not on record	2
Brisbane, AU	1
Bronx, US	1
San Diego, US	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
University of Stellenboschlocation not on record	1

11 institutions · 28 of 43 vouchered records shown · 9 without an institution code

09Environmental DNA2 detections

Where the DNA of Liagora boergesenii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.0 °C 16.6–17.4

Seasonal swing summer↔winter9.90 °C

Max temp (day)20.7 °C 20.6–20.7

Min temp (night)13.0 °C 12.6–13.4

Precipitation129 mm/mo 76.7–181

Air humidity64.2 % 64.1–64.3

Moisture balance49.6 mm/mo 11.5–87.7

Vapour deficit694 Pa 681–707

Wind speed1.00 m/s 0.9–1.00

Cloud cover48.0 % 42.3–53.7

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)