Lascoria orneodalis

Guenée, 1854 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Erebidae/Lascoria

At a glance

Occurrence records134

Data sources6

Biological traits0

DNA specimens25

eDNA detections3

Sources6 archives

Databases and archives Lascoria orneodalis's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility134 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics25 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF134 records

Environmental DNA1 datasets · 2 countries3 detections

DNA & barcodingBOLD25 specimens

01Narrative

Lascoria orneodalis is a species of litter moth in the family Erebidae. It is found in tropical and subtropical America. The larvae feed on species of Lycopersicon.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding25 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Lascoria orneodalis has left across the world's sequence archives.

At a glance

DNA specimens25

BINs1

Marker genes1

eDNA detections3

Countries9

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus19 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 2 variable positions, in barcode order

4Amostly conserved

616Tmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCAGGTATAGTAGGAACTTCTCTAAGATTATTAATTCGAGCTGAATTAGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.19%

Haplotypes4

BIN1

Most divergent pair1.2%

N.AmericaS.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Lascoria majoralissame genus3.0%Lascoria aonsame genus3.7%Lascoria comasame genus3.8%Lascoria alucitalissame genus3.8%Lascoria ambigualissame genus4.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type134 records

Wild obs. + sensor46

Museum / vouchered88

Range

Area of Occupancy AOO332 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy61% within 1 km

≤100 m 14≤1 km 13≤10 km 9>10 km 8

44 georeferenced · 2 without coordinates

Open the mapobservation + sensor46

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy41% within 1 km

≤100 m 7≤10 km 8>10 km 2

17 georeferenced · 71 without coordinates

Open the institutions mapphysical evidence88

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
National Biodiversity Institute, Costa Ricalocation not on record	40
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	9
Cambridge, US	7
Tapachula, MX	4
Ciudad de México, MX	4
Washington, US	4
Centre for Biodiversity Genomicslocation not on record	3
Smithsonian Institution, National Museum of Natural Historylocation not on record	1
MZLUlocation not on record	1

9 institutions · 73 of 88 vouchered records shown · 15 without an institution code

09Environmental DNA3 detections

Where the DNA of Lascoria orneodalis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map2 countries0

Grassland1. Forest & Woodland|1.6. Subtropical/Tropic…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.2 °C 15.4–23.2

Seasonal swing summer↔winter4.80 °C

Max temp (day)26.8 °C 18.8–26.8

Min temp (night)20.0 °C 12.4–20.0

Precipitation9.60 mm/mo 9.60–436

Air humidity65.3 % 65.3–71.6

Moisture balance-121 mm/mo -121–325

Vapour deficit980 Pa 525–980

Wind speed3.30 m/s 1.80–3.30

Cloud cover23.3 % 23.3–55.3

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)