Lascoria ambigualis

Walker, 1866 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Erebidae/Lascoria

At a glance

Occurrence records7 882

Data sources7

Biological traits0

DNA specimens122

eDNA detections122

Sources7 archives

Databases and archives Lascoria ambigualis's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility7 882 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI122 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics122 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF7 882 records

Environmental DNA1 datasets · 2 countries122 detections

DNA & barcodingBOLD122 specimens

01Narrative

Lascoria ambigualis, the ambiguous moth, is a litter moth of the family Erebidae. The species was first described by Francis Walker in 1866. It is found in the US from Wisconsin to Maine, south to Florida and Texas. The wingspan is 21–25 mm. Adults are on wing from April to September. There are two generations in Connecticut and multiple broods in Missouri. The larvae feed on Chrysanthemum species, as well as Aster, blackberry and Verbesina. Larvae have also been reared on dead leaves.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding122 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Lascoria ambigualis has left across the world's sequence archives.

At a glance

DNA specimens122

BINs1

Marker genes2

eDNA detections122

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus121 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 7 variable positions, in barcode order

49Cmostly conserved

133Cmostly conserved

250Cmostly conserved

271Cmostly conserved

403Gmostly conserved

412Gmostly conserved

616Tmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCAGGTATAGTAGGAACTTCCTTAAGATTATTAATTCGAGCTGAATTAGGAAACCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.28%

Haplotypes25

BIN1

Most divergent pair1.2%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Lascoria majoralissame genus4.3%Lascoria orneodalissame genus4.3%Lascoria comasame genus5.0%Lascoria aonsame genus5.0%Aristaria nigrifronssame family5.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS

animal barcodefungal barcode

08Occurrence & distribution

Record type7 882 records

Wild obs. + sensor7 386

Museum / vouchered496

Range

Area of Occupancy AOO12 024 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 4 120≤1 km 936≤10 km 377>10 km 731

6 164 georeferenced · 1 222 without coordinates

Open the mapobservation + sensor7 386

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy18% within 1 km

≤100 m 1≤1 km 40≤10 km 171>10 km 20

232 georeferenced · 264 without coordinates

Open the institutions mapphysical evidence496

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mississippi State, US	76
New Haven, US	55
CUlocation not on record	46
Cambridge, US	43
East Lansing, US	41
University of Guelph, Centre for Biodiversity Genomicslocation not on record	23
Cornell University Insect Collectionlocation not on record	22
Georgia Museum of Natural Historylocation not on record	18
ASUlocation not on record	15
Cleveland Museum of Natural History, OH (CLEV)location not on record	13
St. Paul, US	13
Decorah, US	7
University of Alabamalocation not on record	6
Philadelphia, US	5
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	5
UDlocation not on record	3
Universidad Católica de Manizaleslocation not on record	3
SOVTlocation not on record	3
University of Alberta Museums (UAM)location not on record	2
Colorado State Universitylocation not on record	2
Washington, US	2
San Diego, US	1
Centre for Biodiversity Genomicslocation not on record	1

23 institutions · 405 of 496 vouchered records shown · 91 without an institution code

09Environmental DNA122 detections

Where the DNA of Lascoria ambigualis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found122

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 122 detections have coordinates

Open the map2 countries0

GrasslandWetland14. Artificial - Terrestrial|14.1 Arable Land1. Forest & WoodlandTemperate mixed forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.8 °C 12.9–22.5

Seasonal swing summer↔winter26.1 °C

Max temp (day)23.9 °C 18.1–28.2

Min temp (night)15.1 °C 7.90–19.9

Precipitation94.2 mm/mo 82.5–122

Air humidity58.2 % 55.0–60.3

Moisture balance-41.7 mm/mo -76.2–-12.3

Vapour deficit888 Pa 666–1,223

Wind speed3.60 m/s 2.50–6.40

Cloud cover40.1 % 32.9–49.0

CHELSA 1981–2010, ~9 km grid, at location & month of 118 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Lascoria ambigualis

At a glance

Sources7 archives

At a glance

Record type7 882 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions9 of 23 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type7 882 records