Koumansetta rainfordi

Whitley, 1940 · species

image placeholder — illustration coming later

Animalia/Chordata/Perciformes/Gobiidae/Koumansetta

At a glance

Occurrence records1 526

Data sources9

Biological traits7

DNA specimens3

eDNA detections3

Sources9 archives

Databases and archives Koumansetta rainfordi's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility703 records↗

OBISOcean Biodiversity Information System823 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources7 traits

Occurrence & distributionGBIF · OBIS1 526 records

Environmental DNA1 datasets · 2 countries3 detections

DNA & barcodingBOLD3 specimens

01Narrative

Koumansetta rainfordi, the old glory or Court Jester goby, is a species of goby native to tropical reefs of the western Pacific Ocean where it occurs at depths of from 2 to. This species can reach a length of 8.5 cm SL. It can also be found in the aquarium trade. The specific name honours the viticulturalist E. H. Rainford, of the Queensland Agricultural Department, who also collected specimens for the Australian Museum, and in 1924 he collected specimens of this species.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length8.5 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonereef-associated

Uses & economy1

Commercial importanceof no interest

Other traits3

Depth max30 m

Depth min2 m

Vulnerability10

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Koumansetta rainfordi has left across the world's sequence archives.

At a glance

DNA specimens3

BINs1

Marker genes1

eDNA detections3

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 5 variable positions, in barcode order

25Avariable

268Tvariable

415Tvariable

448Cvariable

478Gvariable

CCTCTATCTAGTATTCGGCGCCTGAGCCGGAATAGTAGGCACCGCACTGAGCCTCCTAATTCGGGCCGAACTTAGTCAACCCGGGGCATT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.51%

Haplotypes3

BIN1

Most divergent pair0.77%

Oceania

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Koumansetta hectorisame genus7.7%Amblygobius stethophthalmussame family14.4%Amblygobius decussatussame family14.6%Amblygobius sphynxsame family15.1%Lutjanus erythropterussame order16.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 526 records

Wild obs. + sensor855

Museum / vouchered671

Range

Area of Occupancy AOO1 884 km²

Depth

0–200 m sunlit316

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 6 m · max 38 m · 316 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 495≤1 km 89≤10 km 42>10 km 15

641 georeferenced · 214 without coordinates

Open the mapobservation + sensor855

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy36% within 1 km

≤100 m 10≤1 km 45≤10 km 77>10 km 19

151 georeferenced · 520 without coordinates

Open the institutions mapphysical evidence671

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
CASlocation not on record	63
Toronto, CA	58
	7
Chicago, US	6
Washington, US	5
FishBaselocation not on record	4
Australian Museum, Sydneylocation not on record	2
South African Institute for Aquatic Biodiversitylocation not on record	1

8 institutions · 146 of 671 vouchered records shown · 2 without an institution code

09Environmental DNA3 detections

Where the DNA of Koumansetta rainfordi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.1 °C 24.1–26.5

Seasonal swing summer↔winter3.80 °C

Max temp (day)24.5 °C 24.5–27.1

Min temp (night)23.7 °C 23.7–25.6

Precipitation10.1 mm/mo 10.1–255

Air humidity60.2 % 60.2–63.7

Vapour deficit1,189 Pa 1,189–1,249

Cloud cover42.0 % 42.0–44.6

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Koumansetta rainfordi

At a glance

Sources9 archives

Size & morphology1

Habitat & environment2

Uses & economy1

Other traits3

At a glance

Record type1 526 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions4 of 8 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 526 records