Amblygobius stethophthalmus

(Bleeker, 1851) · species

image placeholder — illustration coming later

Animalia/Chordata/Perciformes/Gobiidae/Amblygobius

At a glance

Occurrence records123

Data sources8

Biological traits6

DNA specimens15

eDNA detections19

Sources8 archives

Databases and archives Amblygobius stethophthalmus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility114 records↗

OBISOcean Biodiversity Information System9 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI19 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics15 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources6 traits

Occurrence & distributionGBIF · OBIS123 records

Environmental DNA1 datasets · 1 countries19 detections

DNA & barcodingBOLD15 specimens

01Narrative

Amblygobius stethophthalmus is een straalvinnige vissensoort uit de familie van grondels (Gobiidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1851 door Bleeker.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length8.5 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonedemersal

Other traits3

Depth max14 m

Depth min1 m

Vulnerability10

05DNA & barcoding15 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amblygobius stethophthalmus has left across the world's sequence archives.

At a glance

DNA specimens15

BINs1

Marker genes1

eDNA detections19

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus15 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.02%

Haplotypes2

BIN1

Most divergent pair0.15%

Where individuals differ — all 1 variable positions, in barcode order

85Amostly conserved

CCTTTACCTAGTATTTGGTGCCTGAGCCGGAATGGTAGGCACAGCACTAAGCCTCCTTATTCGGGCCGAACTTAGTCAACCCGGAGCATT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Amblygobius buanensissame genus11.1%Amblygobius decussatussame genus12.3%Amblygobius albimaculatussame genus12.4%Amblygobius sphynxsame genus13.4%Amblygobius phalaenasame genus13.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type123 records

Wild obs. + sensor109

Museum / vouchered14

Range

Area of Occupancy AOO208 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy76% within 1 km

≤100 m 41≤1 km 28≤10 km 16>10 km 6

91 georeferenced · 18 without coordinates

Open the mapobservation + sensor109

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 14 records without

Open the institutions mapphysical evidence14

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kagoshima University Museumlocation not on record	3
Fisheries Research Laboratory, Mie Universitylocation not on record	1
Toronto, CA	1
Frankfurt am Main	1

4 institutions · 6 of 14 vouchered records shown · 1 without an institution code

09Environmental DNA19 detections

Where the DNA of Amblygobius stethophthalmus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found19

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 19 detections have coordinates

Open the map1 country0

Seagrass bedCoral reef

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median27.7 °C 27.7–27.7

Seasonal swing summer↔winter3.20 °C

Max temp (day)28.2 °C

Min temp (night)26.9 °C

Precipitation44.0 mm/mo

Air humidity63.9 %

Moisture balance-156 mm/mo

Vapour deficit1,333 Pa

Wind speed4.20 m/s

Cloud cover35.9 %

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)