Hapalochlaena lunulata

(Quoy & Gaimard, 1832) · species

image placeholder — illustration coming later

Animalia/Mollusca/Cephalopoda/Octopoda/Octopodidae/Hapalochlaena

At a glance

Occurrence records193

Data sources10

Biological traits5

DNA specimens7

eDNA detections1

Sources10 archives

Databases and archives Hapalochlaena lunulata's data was compiled from.

WikipediaWikimedia Foundation10 languages↗

Animal Diversity WebUniv. of Michigan MZspecies account↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility167 records↗

OBISOcean Biodiversity Information System26 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeADW · Wikipediaarticle

Traits & measurements1 literature sources5 traits

Occurrence & distributionGBIF · OBIS193 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD7 specimens

01Narrative

The greater blue-ringed octopus (Hapalochlaena lunulata) is one of four species of highly venomous blue-ringed octopuses belonging to the family Octopodidae. This particular species of blue-ringed octopus is known as one of the most toxic marine animals in the world.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Size & morphology1

Body length12 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

Other traits2

Depth max20 m

Depth min0 m

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Hapalochlaena lunulata has left across the world's sequence archives.

At a glance

DNA specimens7

BINs4

Marker genes1

eDNA detections1

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 90% of positions are identical in every specimen.

Where individuals differ — all 64 variable positions, in barcode order

22Amostly conserved

25Tmostly conserved

38Cmostly conserved

55Cmostly conserved

64Tmostly conserved

79Tvariable

110Tmostly conserved

118Cmostly conserved

127Tmostly conserved

133Cmostly conserved

139Cvariable

145Amostly conserved

157Tmostly conserved

160Tmostly conserved

205Cmostly conserved

220Tmostly conserved

226Tmostly conserved

238Tmostly conserved

263Cmostly conserved

274Amostly conserved

277Cmostly conserved

283Tmostly conserved

292Tmostly conserved

298Tmostly conserved

316Tvariable

319Amostly conserved

340Cvariable

347Cmostly conserved

348Tmostly conserved

349Cmostly conserved

358Tmostly conserved

385Cmostly conserved

397Tvariable

407Cmostly conserved

421Amostly conserved

427Cvariable

445Cmostly conserved

448Tmostly conserved

451Tmostly conserved

457Tvariable

478Amostly conserved

481Amostly conserved

484Amostly conserved

487Amostly conserved

520Tmostly conserved

526Cmostly conserved

529Amostly conserved

544Tmostly conserved

553Tmostly conserved

559Cmostly conserved

562Tmostly conserved

568Tmostly conserved

574Cmostly conserved

578Tmostly conserved

580Amostly conserved

598Tmostly conserved

601Cmostly conserved

604Cmostly conserved

607Cmostly conserved

610Tmostly conserved

613Tvariable

616Tmostly conserved

631Avariable

652Tmostly conserved

TACATTATATTTTATTTTTGGAATTTGATCTGGTCTCCTAGGTACCTCTTTAAGCTTAATAATTCGAACAGAATTAGGTCAACCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)4.2%

Haplotypes3

BINs3

Most divergent pair3.0%

AsiaOceania

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Hapalochlaena maculosasame genus8.1%Hapalochlaena fasciatasame genus8.2%Amphioctopus fangsiaosame family12.6%Octopus hubbsorumsame family12.6%Octopus oculifersame family12.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type193 records

Wild obs. + sensor142

Museum / vouchered51

Origin

Native3

Range

Area of Occupancy AOO492 km²

Depth

0–200 m sunlit9

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 4 m · max 7.5 m · 9 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy72% within 1 km

≤100 m 35≤1 km 52≤10 km 26>10 km 8

121 georeferenced · 21 without coordinates

Open the mapobservation + sensor142

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy90% within 1 km

≤1 km 9>10 km 1

10 georeferenced · 41 without coordinates

Open the institutions mapphysical evidence51

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	11
Santa Barbara Museum of Natural Historylocation not on record	6
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	3
UM-RSMASlocation not on record	1
Paris, FR	1
Philadelphia, US	1
Australian Institute of Marine Sciencelocation not on record	1
Chicago, US	1

8 institutions · 25 of 51 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Hapalochlaena lunulata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)