Octopus hubbsorum

S.S.Berry, 1953 · species

image placeholder — illustration coming later

Animalia/Mollusca/Cephalopoda/Octopoda/Octopodidae/Octopus

At a glance

Occurrence records295

Data sources8

Biological traits6

DNA specimens156

eDNA detections200

Sources8 archives

Databases and archives Octopus hubbsorum's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility250 records↗

OBISOcean Biodiversity Information System45 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI200 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics156 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources6 traits

Occurrence & distributionGBIF · OBIS295 records

Environmental DNA1 datasets · 6 countries200 detections

DNA & barcodingBOLD156 specimens

01Narrative

Octopus hubbsorum is een soort in de taxonomische indeling van de inktvissen, een klasse dieren die tot de stam der weekdieren (Mollusca) behoort. De inktvis komt enkel in zout water voor en is in staat om van kleur te veranderen. Hij beweegt zich voort door water in zijn mantel te pompen en het er via de sifon weer krachtig uit te persen. De inktvis is een carnivoor en zijn voedsel bestaat voornamelijk uit vis, krabben, kreeften en weekdieren die ze met de zuignappen op hun grijparmen vangen. De inktvis komt uit het geslacht Octopus en behoort tot de familie Octopodidae. Octopus hubbsorum werd in 1953 beschreven door Berry.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Size & morphology1

Body length22 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

Uses & economy1

Commercial importancecommercial

Other traits2

Depth max30 m

Depth min0 m

05DNA & barcoding156 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Octopus hubbsorum has left across the world's sequence archives.

At a glance

DNA specimens156

BINs1

Marker genes1

eDNA detections200

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P665 bp consensus156 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 1 variable positions, in barcode order

389Tmostly conserved

TTGGAACACTATATTTTATTTTTGGAATTTGATCAGGACTTTTAGGTACCTCTCTAAGTTTAATAATTCGAACAGAATTAGGTCAACCAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.13%

Haplotypes21

BIN1

Most divergent pair0.60%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Octopus tagangasame genus5.9%Octopus tayronasame genus6.8%Octopus insularissame genus6.8%Octopus mayasame genus7.8%Octopus hummelinckisame genus8.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type295 records

Wild obs. + sensor177

Museum / vouchered118

Range

Area of Occupancy AOO796 km²

Depth

0–200 m sunlit7

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 6.5 m · max 9.1 m · 7 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 81≤1 km 28≤10 km 17>10 km 4

130 georeferenced · 47 without coordinates

Open the mapobservation + sensor177

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy25% within 1 km

≤100 m 2≤1 km 5≤10 km 13>10 km 8

28 georeferenced · 90 without coordinates

Open the institutions mapphysical evidence118

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Santa Barbara Museum of Natural Historylocation not on record	47
Washington, US	19
CASlocation not on record	12
UM-RSMASlocation not on record	2
Laboratorio de Ecosistemas Marinos y Acuicultura, Centro Universitario de Ciencias Biológicas y Agropecuarias, Universidad de Guadalajaralocation not on record	1

5 institutions · 81 of 118 vouchered records shown · 12 without an institution code

09Environmental DNA200 detections

Where the DNA of Octopus hubbsorum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found200

Studies independent surveys1

Countries6

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 200 detections have coordinates

Open the map6 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.3 °C 19.0–26.2

Seasonal swing summer↔winter13.9 °C

Max temp (day)26.9 °C 22.0–29.4

Min temp (night)21.1 °C 17.1–23.2

Precipitation12.5 mm/mo 6.70–200

Air humidity54.3 % 48.6–68.7

Moisture balance-125 mm/mo -146–62.2

Vapour deficit1,330 Pa 828–1,505

Wind speed3.00 m/s 1.10–4.00

Cloud cover21.1 % 18.0–58.0

CHELSA 1981–2010, ~9 km grid, at location & month of 46 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)