Habronattus clypeatus

(Banks, 1895) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Salticidae/Habronattus

At a glance

Occurrence records448

Data sources8

Biological traits0

DNA specimens9

eDNA detections9

Sources8 archives

Databases and archives Habronattus clypeatus's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility448 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF448 records

Environmental DNA1 datasets · 1 countries9 detections

DNA & barcodingBOLD9 specimens

01Narrative

Habronattus clypeatus is a species of jumping spider which occurs in the United States and Mexico. Its range extends from the southern Rocky Mountains to the northern Sierra Madre Occidental and Sonoran Desert. It belongs to the viridipes species group within the genus Habronattus.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Habronattus clypeatus has left across the world's sequence archives.

At a glance

DNA specimens9

BINs2

Marker genes1

eDNA detections9

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 26 variable positions, in barcode order

61Gmostly conserved

68Amostly conserved

79Tmostly conserved

100Cvariable

112Amostly conserved

169Gmostly conserved

184Gmostly conserved

199Amostly conserved

202Amostly conserved

208Gmostly conserved

212Tmostly conserved

286Amostly conserved

310Gmostly conserved

313Amostly conserved

319Tmostly conserved

325Amostly conserved

334Amostly conserved

352Amostly conserved

382Gvariable

460Cvariable

496Gmostly conserved

580Avariable

583Gmostly conserved

622Tmostly conserved

640Tmostly conserved

643Gmostly conserved

AACTTTATATTTAATTTTTGGTGCTTGGGCCGCTATAGTGGGTACTGCTATAAGAATGTTGATTCGTATAGAATTAGGTCAAACTGGTAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.6%

Haplotypes4

BINs2

Most divergent pair3.0%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Habronattus borealissame genus5.5%Habronattus viridipessame genus5.5%Habronattus mexicanussame genus5.8%Habronattus jucundussame genus6.5%Habronattus calcaratussame genus6.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type448 records

Wild obs. + sensor344

Museum / vouchered104

Range

Area of Occupancy AOO932 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy65% within 1 km

≤100 m 118≤1 km 90≤10 km 7>10 km 107

322 georeferenced · 22 without coordinates

Open the mapobservation + sensor344

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy16% within 1 km

≤100 m 2≤1 km 1≤10 km 10>10 km 6

19 georeferenced · 85 without coordinates

Open the institutions mapphysical evidence104

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Denver, US	32
Severin-McDaniel Insect Collectionlocation not on record	31
Albuquerque, US	19
US	15
Awka, NG	4
Essig Museum of Entomologylocation not on record	2
Centre for Biodiversity Genomicslocation not on record	1

7 institutions · 104 of 104 vouchered records shown

09Environmental DNA9 detections

Where the DNA of Habronattus clypeatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median28.1 °C 27.6–28.1

Seasonal swing summer↔winter19.8 °C

Max temp (day)33.8 °C 33.2–33.8

Min temp (night)22.7 °C 22.5–22.7

Precipitation79.1 mm/mo 46.7–79.1

Air humidity50.1 % 50.1–52.1

Moisture balance-80.6 mm/mo -143–-80.6

Vapour deficit1,898 Pa 1,771–1,898

Wind speed1.30 m/s 1.30–3.60

Cloud cover17.8 % 17.8–24.7

CHELSA 1981–2010, ~9 km grid, at location & month of 9 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)