Habronattus borealis

(Banks, 1895) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Salticidae/Habronattus

At a glance

Occurrence records282

Data sources9

Biological traits0

DNA specimens39

eDNA detections43

Sources9 archives

Databases and archives Habronattus borealis's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility282 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI43 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics39 specimens↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome ~5.60 Gbp↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF282 records

Environmental DNA1 datasets · 7 countries43 detections

DNA & barcodingBOLD39 specimens

Genome at a glanceGoaT5.6 Gbp

01Narrative

Habronattus borealis is a species of jumping spiders from the family Salticidae, found in Canada and the United States.Distribution Male face Male dorsal Female face Female dorsal

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding39 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Habronattus borealis has left across the world's sequence archives.

At a glance

DNA specimens39

BINs4

Marker genes1

eDNA detections43

Countries7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus34 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 92% of positions are identical in every specimen.

Where individuals differ — all 50 variable positions, in barcode order

28Gvariable

40Avariable

52Gmostly conserved

67Tmostly conserved

70Amostly conserved

79Tmostly conserved

97Gmostly conserved

100Tmostly conserved

127Tmostly conserved

166Amostly conserved

172Cvariable

187Cmostly conserved

196Amostly conserved

202Amostly conserved

208Gmostly conserved

211Amostly conserved

214Gmostly conserved

217Gmostly conserved

235Tmostly conserved

251Tmostly conserved

271Tmostly conserved

286Amostly conserved

289Amostly conserved

307Amostly conserved

334Amostly conserved

343Cvariable

346Amostly conserved

349Amostly conserved

352Amostly conserved

358Amostly conserved

379Gmostly conserved

382Gmostly conserved

433Amostly conserved

457Amostly conserved

458Amostly conserved

475Tmostly conserved

481Amostly conserved

487Avariable

493Gmostly conserved

496Amostly conserved

508Amostly conserved

511Amostly conserved

514Amostly conserved

526Gmostly conserved

541Amostly conserved

559Gmostly conserved

562Amostly conserved

565Gmostly conserved

577Amostly conserved

592Amostly conserved

AACTTTATATTTAATTTTTGGTGCTTGGGCTGCTATAGTAGGTACTGCTATGAGAATATTAATTCGTATAGAATTAGGTCAAACTGGTAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.0%

Haplotypes18

BINs4

Most divergent pair5.0%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Habronattus clypeatussame genus5.5%Habronattus jucundussame genus5.8%Habronattus viridipessame genus6.2%Habronattus oregonensissame genus6.2%Habronattus calcaratussame genus6.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT

The complete instruction manual Habronattus borealis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size5 603 940 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

THIS GENOME Habronattus borealis5.6 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

08Occurrence & distribution

Record type282 records

Wild obs. + sensor209

Museum / vouchered73

Range

Area of Occupancy AOO720 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 116≤1 km 42≤10 km 4>10 km 19

181 georeferenced · 28 without coordinates

Open the mapobservation + sensor209

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy31% within 1 km

≤100 m 5≤1 km 3≤10 km 17>10 km 1

26 georeferenced · 47 without coordinates

Open the institutions mapphysical evidence73

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cambridge, US	19
Ohio State University Acarology Laboratorylocation not on record	11
US	10
Albuquerque, US	5
University of Guelph, Centre for Biodiversity Genomicslocation not on record	3
Chicago, US	2
Denver, US	2
Edmonton, CA	2
Chicago, US	2
Champaign, US	2
Cincinnati, US	1
WIlocation not on record	1
Centre for Biodiversity Genomicslocation not on record	1
Muzeum i Instytut Zoologii Polskiej Akademii Nauklocation not on record	1

14 institutions · 62 of 73 vouchered records shown · 11 without an institution code

09Environmental DNA43 detections

Where the DNA of Habronattus borealis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found43

Studies independent surveys1

Countries7

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 43 detections have coordinates

Open the map7 countries0

BeachForest1. Forest & Woodland | 1.1. Boreal ForestMixed Habitat4. Native Grassland | 4.4. Temperate Grassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.5 °C 14.4–28.2

Seasonal swing summer↔winter23.4 °C

Max temp (day)25.7 °C 18.2–32.9

Min temp (night)19.0 °C 9.70–24.7

Precipitation90.7 mm/mo 55.6–136

Air humidity58.3 % 54.4–65.1

Moisture balance-60.0 mm/mo -97.2–46.8

Vapour deficit1,063 Pa 690–1,488

Wind speed2.80 m/s 1.60–5.70

Cloud cover29.9 % 22.8–40.2

CHELSA 1981–2010, ~9 km grid, at location & month of 43 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)