Habronattus americanus

(Keyserling, 1885) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Salticidae/Habronattus

At a glance

Occurrence records848

Data sources8

Biological traits0

DNA specimens120

eDNA detections108

Sources8 archives

Databases and archives Habronattus americanus's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility848 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI108 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics120 specimens↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF848 records

Environmental DNA1 datasets · 2 countries108 detections

DNA & barcodingBOLD120 specimens

01Narrative

Habronattus americanus is a species of jumping spiders from the family Salticidae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding120 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Habronattus americanus has left across the world's sequence archives.

At a glance

DNA specimens120

BINs5

Marker genes2

eDNA detections108

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P401 bp consensus112 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 20 variable positions, in barcode order

14Tmostly conserved

29Avariable

30Tvariable

53Gmostly conserved

65Tvariable

80Tmostly conserved

83Tvariable

95Gvariable

113Avariable

230Avariable

258Gmostly conserved

260Amostly conserved

261Tmostly conserved

269Gmostly conserved

279Tmostly conserved

281Gvariable

284Avariable

293Avariable

324Tmostly conserved

332Tvariable

TTTGATTATTACCTCCTTCATTAATATTATTATTTATTTCTTCGATAGTAGAGATGGGAGTTGGTGCTGGGTGAACGGTTTATCCTCCTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.9%

Haplotypes18

BINs3

Most divergent pair4.0%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Habronattus sansonisame genus2.0%Habronattus carolinensissame genus7.5%Habronattus decorussame genus8.0%Habronattus borealissame genus8.5%Habronattus mexicanussame genus8.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P16S

animal barcoderibosomal

08Occurrence & distribution

Record type848 records

Wild obs. + sensor516

Museum / vouchered332

Range

Area of Occupancy AOO1 704 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy64% within 1 km

≤100 m 177≤1 km 78≤10 km 21>10 km 123

399 georeferenced · 117 without coordinates

Open the mapobservation + sensor516

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy60% within 1 km

≤100 m 6≤1 km 12≤10 km 9>10 km 3

30 georeferenced · 302 without coordinates

Open the institutions mapphysical evidence332

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Severin-McDaniel Insect Collectionlocation not on record	72
Denver, US	27
CASlocation not on record	10
San Francisco, US	8
The College of Idaho, Orma J. Smith Museum of Natural Historylocation not on record	3
Cambridge, US	2
Vancouver, CA	2
University of Guelphlocation not on record	2
University of Guelph, Centre for Biodiversity Genomicslocation not on record	1
Centre for Biodiversity Genomicslocation not on record	1

10 institutions · 128 of 332 vouchered records shown · 105 without an institution code

09Environmental DNA108 detections

Where the DNA of Habronattus americanus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found108

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 108 detections have coordinates

Open the map2 countries0

Grassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.0 °C 13.4–16.0

Seasonal swing summer↔winter20.3 °C

Max temp (day)21.4 °C 20.2–23.5

Min temp (night)6.60 °C 6.60–8.40

Precipitation18.0 mm/mo 12.2–28.0

Air humidity44.3 % 43.9–45.9

Moisture balance-160 mm/mo -160–-139

Vapour deficit892 Pa 834–989

Wind speed3.60 m/s 1.50–5.00

Cloud cover13.9 % 12.9–14.3

CHELSA 1981–2010, ~9 km grid, at location & month of 108 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)