Habronattus agilis

(Banks, 1893) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Salticidae/Habronattus

At a glance

Occurrence records102

Data sources8

Biological traits0

DNA specimens34

eDNA detections36

Sources8 archives

Databases and archives Habronattus agilis's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility102 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI36 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics34 specimens↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF102 records

Environmental DNA1 datasets · 3 countries36 detections

DNA & barcodingBOLD34 specimens

01Narrative

Habronattus agilis is a species of jumping spider in the family Salticidae. It is found in the United States.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding34 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Habronattus agilis has left across the world's sequence archives.

At a glance

DNA specimens34

BINs3

Marker genes1

eDNA detections36

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus27 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 29 variable positions, in barcode order

28Gvariable

70Gmostly conserved

73Amostly conserved

112Amostly conserved

145Avariable

163Avariable

214Gvariable

217Gvariable

235Tmostly conserved

263Tmostly conserved

271Cvariable

283Amostly conserved

304Avariable

319Avariable

349Gvariable

352Gmostly conserved

355Cmostly conserved

364Tmostly conserved

370Gmostly conserved

373Gvariable

391Tmostly conserved

421Cmostly conserved

433Amostly conserved

457Amostly conserved

474Cvariable

475Avariable

500Tmostly conserved

557Tmostly conserved

598Tvariable

AACTTTATATTTAATTTTTGGTGCTTGGGCTGCTATAGTAGGGACTGCTATAAGAATACTGATTCGGTTGGAATTAGGTCAAACTGGTAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.9%

Haplotypes12

BINs3

Most divergent pair3.6%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Pellenes tharinaesame family8.5%Pellenes seriatussame family9.2%Habronattus borealissame genus9.4%Pellenes tripunctatussame family9.6%Habronattus paratussame genus9.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type102 records

Wild obs. + sensor33

Museum / vouchered69

Range

Area of Occupancy AOO204 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 19≤1 km 4>10 km 3

26 georeferenced · 7 without coordinates

Open the mapobservation + sensor33

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy26% within 1 km

≤100 m 12≤10 km 34

46 georeferenced · 23 without coordinates

Open the institutions mapphysical evidence69

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Champaign, US	36
University of Guelph, Centre for Biodiversity Genomicslocation not on record	7
Chicago, US	4
Cambridge, US	4
Albuquerque, US	3
Centre for Biodiversity Genomicslocation not on record	2
Ohio State University Acarology Laboratorylocation not on record	1
Muzeum i Instytut Zoologii Polskiej Akademii Nauklocation not on record	1
US	1

9 institutions · 59 of 69 vouchered records shown · 10 without an institution code

09Environmental DNA36 detections

Where the DNA of Habronattus agilis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found36

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 36 detections have coordinates

Open the map3 countries0

ForestBeachGrassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.6 °C 19.3–28.1

Seasonal swing summer↔winter19.3 °C

Max temp (day)25.7 °C 21.7–33.8

Min temp (night)19.9 °C 17.4–22.7

Precipitation54.6 mm/mo 8.20–104

Air humidity58.0 % 49.7–61.0

Moisture balance-97.2 mm/mo -180–-41.6

Vapour deficit1,234 Pa 875–1,811

Wind speed3.90 m/s 2.20–6.10

Cloud cover26.3 % 18.1–39.2

CHELSA 1981–2010, ~9 km grid, at location & month of 36 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)