Gonepteryx aspasia

Ménétriès, 1859 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Pieridae/Gonepteryx

At a glance

Occurrence records884

Data sources6

Biological traits0

DNA specimens27

eDNA detections33

Sources6 archives

Databases and archives Gonepteryx aspasia's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility884 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI33 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics27 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF884 records

Environmental DNA1 datasets · 4 countries33 detections

DNA & barcodingBOLD27 specimens

01Narrative

Gonepteryx aspasia is een vlindersoort uit de familie Pieridae (witjes) en de onderfamilie Coliadinae. De wetenschappelijke naam werd in 1858 gepubliceerd door Ménétriés.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding27 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Gonepteryx aspasia has left across the world's sequence archives.

At a glance

DNA specimens27

BINs2

Marker genes1

eDNA detections33

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus25 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 19 variable positions, in barcode order

1Cvariable

49Avariable

61Amostly conserved

94Amostly conserved

187Cmostly conserved

202Gvariable

274Cmostly conserved

278Cmostly conserved

298Tmostly conserved

358Tmostly conserved

364Cmostly conserved

427Cmostly conserved

542Cvariable

562Amostly conserved

581Cvariable

616Tmostly conserved

619Amostly conserved

628Gvariable

631Tvariable

CACTTTATATTTTATTTTTGGAATTTGATCAGGAATAGTAGGAACATCATTAAGTTTATTAATTCGAACAGAATTAGGAAATCCAGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.8%

Haplotypes9

BINs2

Most divergent pair2.0%

EuropeAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Gonepteryx taiwanasame genus2.1%Gonepteryx rhamnisame genus4.6%Gonepteryx cleobulesame genus4.7%Gonepteryx cleopatrasame genus4.9%Gonepteryx maderensissame genus4.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type884 records

Wild obs. + sensor173

Museum / vouchered711

Range

Area of Occupancy AOO1 772 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy62% within 1 km

≤100 m 21≤1 km 27≤10 km 12>10 km 18

78 georeferenced · 95 without coordinates

Open the mapobservation + sensor173

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy55% within 1 km

≤100 m 3≤1 km 91≤10 km 30>10 km 46

170 georeferenced · 541 without coordinates

Open the institutions mapphysical evidence711

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 30 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Iwate Prefectural Museumlocation not on record	347
Natural History Museum, Tribhuvan Universitylocation not on record	50
Obihiro Centennial City Museumlocation not on record	35
RCMlocation not on record	34
Toyama, JP	29
KIRMlocation not on record	25
Helsinki, FI	21
Tartu, EE	18
JP	16
Nagatoro-machi, Chichibu-gun, JP	16
Gifu prefectural Museumlocation not on record	15
Shiojiri City Museum of Natural Historylocation not on record	15
Tomioka, JP	15
Kawasaki Shi Tama Ku, JP	13
KOMlocation not on record	12
Tokushima, JP	8
Oiso Municipal Museumlocation not on record	7
Sanda, JP	6
Haus der Natur, Salzburglocation not on record	5
Zürich, CH	4
MJINlocation not on record	4
Yamaguchi-shi, JP	3
Toyota city nature sanctuarylocation not on record	3
Saga Prefectural Space and Science Museumlocation not on record	1
Natural History Museum of Utahlocation not on record	1
Philadelphia, US	1
Sagamihara, JP	1
Chungbuk National Universitylocation not on record	1
Chiba, JP	1
NMOKlocation not on record	1

30 institutions · 708 of 711 vouchered records shown · 3 without an institution code

09Environmental DNA33 detections

Where the DNA of Gonepteryx aspasia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found33

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 33 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.4 °C 10.0–22.4

Seasonal swing summer↔winter27.3 °C

Max temp (day)20.2 °C 15.7–25.8

Min temp (night)14.2 °C 5.00–18.2

Precipitation170 mm/mo 68.9–277

Air humidity64.1 % 53.8–72.8

Moisture balance40.4 mm/mo -44.9–166

Vapour deficit685 Pa 508–1,043

Wind speed2.70 m/s 1.90–3.70

Cloud cover40.7 % 28.2–55.8

CHELSA 1981–2010, ~9 km grid, at location & month of 23 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)