Gnorimoschema septentrionella

Fyles, 1911 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Gelechiidae/Gnorimoschema

At a glance

Occurrence records62

Data sources8

Biological traits0

DNA specimens55

eDNA detections57

Sources8 archives

Databases and archives Gnorimoschema septentrionella's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility62 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI57 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics55 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF62 records

Environmental DNA1 datasets · 1 countries57 detections

DNA & barcodingBOLD55 specimens

01Narrative

Gnorimoschema septentrionella is a moth in the family Gelechiidae. It was described by Fyles in 1911. It is found in North America, where it has been recorded from Alberta, British Columbia, Maine, Michigan, Minnesota, Quebec and Saskatchewan.funet.fimothphotographersgroup The wingspan is about 20 mm. The forewings are brown, with the costal half of the wing a warmer hue than the inner half. The outward third of this costal part is striped with brown and rosy grey. The hindwings are dark grey. The larvae feed on Aster junceus. They form a gall on their host plant.Can. Ent. 43 (12) : 422

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding55 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Gnorimoschema septentrionella has left across the world's sequence archives.

At a glance

DNA specimens55

BINs1

Marker genes1

eDNA detections57

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus53 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 5 variable positions, in barcode order

101Amostly conserved

322Gmostly conserved

368Amostly conserved

520Amostly conserved

562Tmostly conserved

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTTGGAATATCCTTAAGATTATTAATTCGAGCTGAATTAGGAAATCCTGAATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.64%

Haplotypes12

BIN1

Most divergent pair1.5%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Gnorimoschema jocelynaesame genus2.1%Gnorimoschema gallaespeciosumsame genus2.7%Gnorimoschema gallaeasterellasame genus4.1%Gnorimoschema bacchariselloidessame genus4.1%Gnorimoschema gibsoniellasame genus4.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type62 records

Wild obs. + sensor11

Museum / vouchered51

Range

Area of Occupancy AOO140 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 9>10 km 1

10 georeferenced · 1 without coordinates

Open the mapobservation + sensor11

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 50 without coordinates

Open the institutions mapphysical evidence51

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Alberta Museums (UAM)location not on record	20
St. Paul, US	13
University of Guelph, Centre for Biodiversity Genomicslocation not on record	4
Cornell University Insect Collectionlocation not on record	3
Research Collection of Charles Birdlocation not on record	2
Mississippi State, US	1

6 institutions · 43 of 51 vouchered records shown · 8 without an institution code

09Environmental DNA57 detections

Where the DNA of Gnorimoschema septentrionella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found57

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 57 detections have coordinates

Open the map1 country0

Forest1. Forest & Woodland|1.1. Boreal Forest1. Forest & Woodland|1.1 Boreal ForestGrassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.7 °C 12.5–17.6

Seasonal swing summer↔winter26.4 °C

Max temp (day)22.1 °C 18.5–23.6

Min temp (night)11.6 °C 7.10–15.1

Precipitation68.5 mm/mo 52.7–97.6

Air humidity57.0 % 52.7–59.8

Moisture balance-57.6 mm/mo -75.5–-21.6

Vapour deficit787 Pa 673–931

Wind speed2.90 m/s 1.90–4.10

Cloud cover36.1 % 33.7–41.3

CHELSA 1981–2010, ~9 km grid, at location & month of 57 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)