Gnorimoschema gallaeasterella

(Kellicott, 1878) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Gelechiidae/Gnorimoschema

At a glance

Occurrence records104

Data sources8

Biological traits0

DNA specimens31

eDNA detections33

Sources8 archives

Databases and archives Gnorimoschema gallaeasterella's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility104 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI33 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics31 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF104 records

Environmental DNA1 datasets · 2 countries33 detections

DNA & barcodingBOLD31 specimens

01Narrative

Gnorimoschema gallaeasterella is a moth in the family Gelechiidae. It was described by D. S. Kellicott in 1878. It is found in North America, where it has been recorded from Alberta, California, Illinois, Kentucky, Maine, Maryland, New Hampshire, Oklahoma, Quebec and Tennessee. The wingspan is about 20 mm. The forewings are white, speckled with brown and black and with a brown patch occupying the costal half of the middle third. It is darkest towards the base. Bordering the hind margin of the patch is a distinct dark brown line which terminates in a hook and just behind the middle of the patch are two short, parallel black dashes. Beyond these, in line with the apex, is a short, black, irregular mark. The hindwings are grey.Kellicott, 1878. A new gall moth and notes on the larvae of other gall moths. The Canadian Entomologist. 10: 203 Adults are on wing from June to October. The larvae feed on Aster corymbosus and Solidago species. They form spindle galls on their host plant.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding31 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Gnorimoschema gallaeasterella has left across the world's sequence archives.

At a glance

DNA specimens31

BINs2

Marker genes1

eDNA detections33

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus30 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 36 variable positions, in barcode order

45Cmostly conserved

49Amostly conserved

87Gmostly conserved

101Gmostly conserved

112Tmostly conserved

169Tmostly conserved

178Cmostly conserved

187Tvariable

217Amostly conserved

235Cvariable

266Tvariable

271Cmostly conserved

274Amostly conserved

282Tmostly conserved

317Amostly conserved

322Amostly conserved

347Tmostly conserved

352Amostly conserved

364Cmostly conserved

368Gmostly conserved

394Tmostly conserved

400Cmostly conserved

436Tvariable

466Avariable

506Gmostly conserved

508Tmostly conserved

517Amostly conserved

526Avariable

547Amostly conserved

548Cmostly conserved

550Tmostly conserved

574Amostly conserved

586Amostly conserved

616Tmostly conserved

619Tmostly conserved

625Gvariable

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTTGGAACATCATTAAGATTATTAATTCGAGCTGAATTAGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.7%

Haplotypes9

BINs2

Most divergent pair5.3%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Gnorimoschema gallaesolidaginissame genus2.6%Gnorimoschema bacchariselloidessame genus3.8%Gnorimoschema gibsoniellasame genus4.1%Gnorimoschema septentrionellasame genus4.1%Gnorimoschema jocelynaesame genus4.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type104 records

Wild obs. + sensor51

Museum / vouchered53

Range

Area of Occupancy AOO308 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy73% within 1 km

≤100 m 23≤1 km 7≤10 km 2>10 km 9

41 georeferenced · 10 without coordinates

Open the mapobservation + sensor51

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy38% within 1 km

≤1 km 6≤10 km 8>10 km 2

16 georeferenced · 37 without coordinates

Open the institutions mapphysical evidence53

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
St. Paul, US	12
Philadelphia, US	9
Washington, US	8
Cornell University Insect Collectionlocation not on record	7
University of Guelph, Centre for Biodiversity Genomicslocation not on record	3
University of Alberta Museums (UAM)location not on record	1
East Lansing, US	1

7 institutions · 41 of 53 vouchered records shown · 12 without an institution code

09Environmental DNA33 detections

Where the DNA of Gnorimoschema gallaeasterella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found33

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 33 detections have coordinates

Open the map2 countries0

Temperate mixed forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.2 °C 9.80–19.4

Seasonal swing summer↔winter26.4 °C

Max temp (day)20.6 °C 16.1–24.4

Min temp (night)11.8 °C 6.20–15.5

Precipitation87.4 mm/mo 58.6–109

Air humidity60.3 % 56.2–61.4

Moisture balance-3.50 mm/mo -41.6–32.1

Vapour deficit683 Pa 520–910

Wind speed3.40 m/s 2.30–4.40

Cloud cover48.2 % 40.0–56.3

CHELSA 1981–2010, ~9 km grid, at location & month of 31 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)