Gaurotes cyanipennis

(Say, 1824) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Cerambycidae/Gaurotes

At a glance

Occurrence records830

Data sources7

Biological traits0

DNA specimens142

eDNA detections142

Sources7 archives

Databases and archives Gaurotes cyanipennis's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility830 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI142 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics142 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF830 records

Environmental DNA1 datasets · 2 countries142 detections

DNA & barcodingBOLD142 specimens

01Narrative

Gaurotes cyanipennis is a species of beetle in the family Cerambycidae. It was described by Say in 1824.Bezark, Larry G. A Photographic Catalog of the Cerambycidae of the World . Retrieved on 22 May 2012.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding142 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Gaurotes cyanipennis has left across the world's sequence archives.

At a glance

DNA specimens142

BINs1

Marker genes2

eDNA detections142

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P636 bp consensus116 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 14 variable positions, in barcode order

28Amostly conserved

40Cvariable

82Cvariable

214Cmostly conserved

217Avariable

229Gmostly conserved

316Gvariable

463Tvariable

472Tmostly conserved

475Avariable

542Tvariable

544Gmostly conserved

565Avariable

619Amostly conserved

AATACTATACTTCATTTTTGGTGCCTGAGCAGGAATAGTCGGAACTTCCCTAAGTTTATTAATTCGATCAGAACTTGGTAACCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.5%

Haplotypes20

BIN1

Most divergent pair3.0%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Dinoptera collarissame family11.2%Euracmaeops septentrionissame family11.5%Dinoptera minutasame family11.8%Acmaeops proteussame family12.1%Gaurotes virgineasame genus12.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type830 records

Wild obs. + sensor530

Museum / vouchered300

Range

Area of Occupancy AOO2 208 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 263≤1 km 113≤10 km 26>10 km 55

457 georeferenced · 73 without coordinates

Open the mapobservation + sensor530

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy44% within 1 km

≤100 m 22≤1 km 15≤10 km 47

84 georeferenced · 216 without coordinates

Open the institutions mapphysical evidence300

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Guelph, Centre for Biodiversity Genomicslocation not on record	59
University Park, US	39
CUlocation not on record	20
OSUClocation not on record	18
Champaign, US	14
MAJClocation not on record	10
University of Guelphlocation not on record	10
Lexington, US	9
Natural History Museum of Utahlocation not on record	7
UDlocation not on record	5
SOVTlocation not on record	4
Chicago, US	2
WIlocation not on record	2
Espace pour la vielocation not on record	2
University of Alberta Museums (UAM)location not on record	2
Saint John, CA	2
Philadelphia, US	1
Lubbock, US	1
Biodiversity Institute of Ontariolocation not on record	1
Washington, US	1
Toronto, CA	1
Blacksburg, US	1

22 institutions · 211 of 300 vouchered records shown · 89 without an institution code

09Environmental DNA142 detections

Where the DNA of Gaurotes cyanipennis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found142

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 142 detections have coordinates

Open the map2 countries0

1. Forest & WoodlandTemperate mixed forestforest canopyWetlandGrasslandForest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.8 °C 12.7–18.6

Seasonal swing summer↔winter27.5 °C

Max temp (day)21.5 °C 17.4–23.5

Min temp (night)11.6 °C 8.00–14.2

Precipitation107 mm/mo 84.7–139

Air humidity57.7 % 55.6–58.7

Moisture balance-21.8 mm/mo -57.7–3.50

Vapour deficit807 Pa 654–887

Wind speed2.80 m/s 2.50–5.30

Cloud cover45.0 % 41.1–48.2

CHELSA 1981–2010, ~9 km grid, at location & month of 138 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)