Acmaeops proteus

(Kirby, 1837) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Cerambycidae/Acmaeops

At a glance

Occurrence records587

Data sources9

Biological traits0

DNA specimens188

eDNA detections187

Sources9 archives

Databases and archives Acmaeops proteus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility587 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI187 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics188 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF587 records

Environmental DNA1 datasets · 2 countries187 detections

DNA & barcodingBOLD188 specimens

Genome at a glanceGoaT · TreeOfSex2n = 22

01Narrative

Acmaeops proteus is a species of the Lepturinae subfamily in the long-horned beetle family.BioLib Taxon profile — species Acmaeops proteus (Kirby, 1837) This beetle is distributed in Canada, Mexico, and the United States. Fungi, Paecilomyces farinosus entomopathogenic species parasite on adult beetles.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding188 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acmaeops proteus has left across the world's sequence archives.

At a glance

DNA specimens188

BINs2

Marker genes1

eDNA detections187

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus171 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

ATATTATATTTTATTTTTGGTGCTTGAGCTGGAATAGTAGGAACTTCTTTAAGTCTATTAATTCGATCAGAATTAGGAAATCCTGGTTCT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.16%

Haplotypes6

BINs2

Most divergent pair0.31%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Euracmaeops septentrionissame family6.0%Dinoptera collarissame family8.4%Pseudogaurotina cressonisame family9.6%Dinoptera minutasame family9.6%Gnathacmaeops pratensissame family10.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · TreeOfSex

The complete instruction manual Acmaeops proteus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidy2× diploid · measured

Chromosome records22–222n range22median22mode5records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 225×GoaT · Animal Chromosome Counts Database · GoaT · Tree of Sex Database · GoaT · Coleoptera Karyotype Database +1

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Tree of Sex Database — ↗

GoaT · Coleoptera Karyotype Database — ↗

TreeOfSex · invert — Smith SG, Virkki N (1978) Animal Cytogenetics Vol. 3 Insecta 5 Coleoptera. Berlin: Gebruder Borntraeger. ↗

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Coleoptera Karyotype Database

GoaT · Coleoptera Karyotype Database

08Occurrence & distribution

Record type587 records

Wild obs. + sensor42

Museum / vouchered545

Range

Area of Occupancy AOO556 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy67% within 1 km

≤100 m 18≤1 km 4≤10 km 4>10 km 7

33 georeferenced · 9 without coordinates

Open the mapobservation + sensor42

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy93% within 1 km

≤100 m 292≤1 km 24≤10 km 21>10 km 3

340 georeferenced · 205 without coordinates

Open the institutions mapphysical evidence545

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Edmonton, CA	331
University of Guelph, Centre for Biodiversity Genomicslocation not on record	61
WIlocation not on record	34
Toronto, CA	25
Saint John, CA	6
Espace pour la vielocation not on record	4
Natural History Museum of Utahlocation not on record	4
University of Guelphlocation not on record	3
Albuquerque, US	1
Canadian National Collection of Insects, Arachnids and Nematodeslocation not on record	1

10 institutions · 470 of 545 vouchered records shown · 75 without an institution code

09Environmental DNA187 detections

Where the DNA of Acmaeops proteus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found187

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 187 detections have coordinates

Open the map2 countries0

pond, emergent sedgeGrasslandgrid 36435Wetland1. Forest & Woodland|1.1. Boreal Forest1. Forest & Woodland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.2 °C 5.20–16.3

Seasonal swing summer↔winter31.7 °C

Max temp (day)17.2 °C 10.8–21.1

Min temp (night)7.10 °C 0–11.8

Precipitation89.7 mm/mo 32.4–148

Air humidity57.2 % 53.4–60.9

Moisture balance-23.3 mm/mo -87.2–29.7

Vapour deficit639 Pa 362–831

Wind speed3.10 m/s 2.10–8.30

Cloud cover39.4 % 35.4–57.6

CHELSA 1981–2010, ~9 km grid, at location & month of 184 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)