Euxoa pimensis

Barnes & McDunnough, 1910 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Euxoa

At a glance

Occurrence records62

Data sources7

Biological traits0

DNA specimens13

eDNA detections16

Sources7 archives

Databases and archives Euxoa pimensis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility62 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI16 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF62 records

Environmental DNA1 datasets · 2 countries16 detections

DNA & barcodingBOLD13 specimens

01Narrative

Euxoa pimensis is a species of cutworm or dart moth in the family Noctuidae first described by William Barnes and James Halliday McDunnough in 1910. It is found in North America. The MONA or Hodges number for Euxoa pimensis is 10752.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Euxoa pimensis has left across the world's sequence archives.

At a glance

DNA specimens13

BINs1

Marker genes1

eDNA detections16

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus13 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 2 variable positions, in barcode order

643Amostly conserved

646Tmostly conserved

AACATTATATTTTATTTTTGGTATTTGAGCAGGAATAATTGGAACTTCTTTAAGATTATTAATTCGGGCTGAATTAGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.05%

Haplotypes3

BIN1

Most divergent pair0.30%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Euxoa silenssame genus2.0%Euxoa redimiculasame genus2.9%Euxoa zernyisame genus2.9%Euxoa simonasame genus3.0%Euxoa costatasame genus3.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type62 records

Wild obs. + sensor7

Museum / vouchered55

Range

Area of Occupancy AOO140 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy20% within 1 km

≤100 m 1≤10 km 4

5 georeferenced · 2 without coordinates

Open the mapobservation + sensor7

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy46% within 1 km

≤100 m 5≤1 km 13≤10 km 20>10 km 1

39 georeferenced · 16 without coordinates

Open the institutions mapphysical evidence55

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
San Diego, US	16
New Haven, US	11
East Lansing, US	5
ASUlocation not on record	4
Colorado State Universitylocation not on record	3
University of Alberta Museums (UAM)location not on record	3
US	2
St. Paul, US	1
Washington, US	1

9 institutions · 46 of 55 vouchered records shown · 9 without an institution code

09Environmental DNA16 detections

Where the DNA of Euxoa pimensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found16

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 16 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.6 °C 17.4–22.4

Seasonal swing summer↔winter21.5 °C

Max temp (day)26.7 °C 25.4–29.4

Min temp (night)11.8 °C 10.5–14.8

Precipitation13.0 mm/mo 4.80–14.9

Air humidity38.5 % 36.0–48.7

Moisture balance-160 mm/mo -181–-128

Vapour deficit1,410 Pa 1,032–1,735

Wind speed2.70 m/s 2.10–3.50

Cloud cover30.6 % 21.4–36.8

CHELSA 1981–2010, ~9 km grid, at location & month of 15 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)