Euxoa redimicula

Morrison, 1874 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Euxoa

At a glance

Occurrence records199

Data sources6

Biological traits0

DNA specimens9

eDNA detections0

Sources6 archives

Databases and archives Euxoa redimicula's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility199 records↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF199 records

DNA & barcodingBOLD9 specimens

01Narrative

Euxoa redimicula, the fillet dart, is a species of cutworm or dart moth in the family Noctuidae. It is found in North America. The MONA or Hodges number for Euxoa redimicula is 10851.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Euxoa redimicula has left across the world's sequence archives.

At a glance

DNA specimens9

BINs1

Marker genes1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 3 variable positions, in barcode order

67Gmostly conserved

343Tmostly conserved

382Avariable

AACATTATATTTTATTTTTGGTATTTGAGCAGGAATAGTTGGAACTTCTTTAAGATTATTAATTCGGGCTGAATTAGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.16%

Haplotypes3

BIN1

Most divergent pair0.46%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Euxoa campestrissame genus1.5%Euxoa auripennissame genus1.5%Euxoa cinnabarinasame genus1.8%Euxoa declaratasame genus1.8%Euxoa rufulasame genus1.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type199 records

Wild obs. + sensor20

Museum / vouchered179

Range

Area of Occupancy AOO380 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy71% within 1 km

≤100 m 7≤1 km 5≤10 km 3>10 km 2

17 georeferenced · 3 without coordinates

Open the mapobservation + sensor20

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy57% within 1 km

≤100 m 6≤1 km 51≤10 km 39>10 km 4

100 georeferenced · 79 without coordinates

Open the institutions mapphysical evidence179

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
East Lansing, US	62
University of Alberta Museums (UAM)location not on record	43
New Haven, US	16
St. Paul, US	16
Denver, US	6
Brussels, BE	4
Cleveland Museum of Natural History, OH (CLEV)location not on record	3
RBINS-Scientific Heritagelocation not on record	3
UNHClocation not on record	3
UDlocation not on record	3
Helsinki, FI	2
Natural History Museum of Utahlocation not on record	2
Royal Saskatchewan Museumlocation not on record	2
Cornell University Insect Collectionlocation not on record	2
Philadelphia, US	1
Colorado State Universitylocation not on record	1

16 institutions · 169 of 179 vouchered records shown · 10 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)