Euxoa olivia

Morrison, 1876 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Euxoa

At a glance

Occurrence records544

Data sources7

Biological traits0

DNA specimens42

eDNA detections40

Sources7 archives

Databases and archives Euxoa olivia's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility544 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI40 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics42 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF544 records

Environmental DNA1 datasets · 2 countries40 detections

DNA & barcodingBOLD42 specimens

01Narrative

Euxoa olivia is a species of cutworm or dart moth in the family Noctuidae. It is found in North America. The MONA or Hodges number for Euxoa olivia is 10741.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding42 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Euxoa olivia has left across the world's sequence archives.

At a glance

DNA specimens42

BINs1

Marker genes1

eDNA detections40

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus41 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 5 variable positions, in barcode order

56Cmostly conserved

118Tmostly conserved

235Tmostly conserved

368Gmostly conserved

541Gvariable

AACATTATATTTTATTTTTGGTATTTGAGCAGGAATAGTTGGAACTTCCTTAAGACTATTAATTCGAGCTGAATTAGGAAACCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.28%

Haplotypes15

BIN1

Most divergent pair0.91%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Euxoa simonasame genus3.3%Euxoa infaustasame genus3.5%Euxoa terrealissame genus3.5%Euxoa pleuriticasame genus3.6%Euxoa satissame genus3.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type544 records

Wild obs. + sensor33

Museum / vouchered511

Range

Area of Occupancy AOO800 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy36% within 1 km

≤100 m 6≤1 km 3≤10 km 15>10 km 1

25 georeferenced · 8 without coordinates

Open the mapobservation + sensor33

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy47% within 1 km

≤100 m 94≤1 km 39≤10 km 108>10 km 45

286 georeferenced · 225 without coordinates

Open the institutions mapphysical evidence511

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Colorado State Universitylocation not on record	141
Vernal, US	71
San Diego, US	67
Oregon State Arthropod Collectionlocation not on record	53
New Haven, US	39
University of Alberta Museums (UAM)location not on record	37
St. Paul, US	20
East Lansing, US	17
Mississippi State, US	16
ASUlocation not on record	11
Albuquerque, US	8
San Francisco, US	4
WWUlocation not on record	3
University of Guelph, Centre for Biodiversity Genomicslocation not on record	2
München, DE	2
Denver, US	1
US	1
Natural History Museum of Utahlocation not on record	1
Royal Saskatchewan Museumlocation not on record	1
US	1
Essig Museum of Entomologylocation not on record	1

21 institutions · 497 of 511 vouchered records shown · 14 without an institution code

09Environmental DNA40 detections

Where the DNA of Euxoa olivia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found40

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 40 detections have coordinates

Open the map2 countries0

PinesMarsh

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.2 °C 8.60–22.8

Seasonal swing summer↔winter22.1 °C

Max temp (day)24.9 °C 13.6–29.7

Min temp (night)12.9 °C 4.30–15.6

Precipitation13.2 mm/mo 6.40–41.0

Air humidity43.4 % 40.1–59.1

Moisture balance-78.8 mm/mo -105–-6.90

Vapour deficit1,160 Pa 461–1,665

Wind speed2.30 m/s 1.50–3.60

Cloud cover25.6 % 21.9–43.4

CHELSA 1981–2010, ~9 km grid, at location & month of 40 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)