Euxoa infausta

Walker, 1865 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Euxoa

At a glance

Occurrence records457

Data sources5

Biological traits0

DNA specimens13

eDNA detections0

Sources5 archives

Databases and archives Euxoa infausta's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility457 records↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF457 records

DNA & barcodingBOLD13 specimens

01Narrative

Euxoa infausta, known generally as the variable dart or dingy dart, is a species of cutworm or dart moth in the family Noctuidae. It is found in North America. The MONA or Hodges number for Euxoa infausta is 10785.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Euxoa infausta has left across the world's sequence archives.

At a glance

DNA specimens13

BINs1

Marker genes1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus12 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.32%

Haplotypes2

BIN1

Most divergent pair0.61%

Where individuals differ — all 4 variable positions, in barcode order

79Avariable

268Tvariable

436Tvariable

622Avariable

AACATTATATTTTATTTTTGGTATTTGAGCAGGAATAGTTGGAACTTCTTTAAGATTATTAATTCGAGCTGAATTAGGAAATCCTGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Euxoa bicollarissame genus2.0%Euxoa brunneigerasame genus2.0%Euxoa auxiliarissame genus2.0%Euxoa flavidenssame genus2.0%Euxoa castaneasame genus2.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type457 records

Wild obs. + sensor14

Museum / vouchered443

Range

Area of Occupancy AOO544 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy27% within 1 km

≤100 m 1≤1 km 2≤10 km 6>10 km 2

11 georeferenced · 3 without coordinates

Open the mapobservation + sensor14

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy27% within 1 km

≤100 m 25≤1 km 6≤10 km 79>10 km 3

113 georeferenced · 330 without coordinates

Open the institutions mapphysical evidence443

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Vernal, US	161
New Haven, US	73
Oregon State Arthropod Collectionlocation not on record	58
University of Alberta Museums (UAM)location not on record	51
Colorado State Universitylocation not on record	30
San Diego, US	23
St. Paul, US	10
Essig Museum of Entomologylocation not on record	5
WWUlocation not on record	4
Helsinki, FI	2
ASUlocation not on record	1
Royal Saskatchewan Museumlocation not on record	1
East Lansing, US	1

13 institutions · 420 of 443 vouchered records shown · 23 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)