Euxoa ochrogaster

Guenée, 1852 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Euxoa

At a glance

Occurrence records1 251

Data sources7

Biological traits0

DNA specimens97

eDNA detections3

Sources7 archives

Databases and archives Euxoa ochrogaster's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 251 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics97 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 251 records

Environmental DNA1 datasets · 2 countries3 detections

DNA & barcodingBOLD97 specimens

01Narrative

Euxoa ochrogaster, the red-backed cutworm, is a moth of the family Noctuidae. It is found from Iceland and northern Europe, through the Baltic to the Amur region. In North America, it is found from Alaska to Newfoundland and Labrador, south into the northern part of the United States, south in Rocky Mountains to Arizona and New Mexico. Adults are on wing from the end of July to beginning of September. The larvae feed on a variety of broad leaf plants and grasses, including Plantago species. The species is economically important on Helianthus annuus in North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding97 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Euxoa ochrogaster has left across the world's sequence archives.

At a glance

DNA specimens97

BINs4

Marker genes2

eDNA detections3

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus95 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 10 variable positions, in barcode order

142Cmostly conserved

190Tvariable

358Cvariable

373Tvariable

412Avariable

477Gvariable

520Avariable

536Tvariable

595Cvariable

628Amostly conserved

AACATTATATTTTATTTTTGGTATTTGAGCAGGAATAGTTGGAACTTCTTTAAGATTATTAATTCGAGCTGAATTAGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.0%

Haplotypes6

BINs4

Most divergent pair1.4%

N.AmericaEuropeAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Euxoa tristissame genus1.7%Euxoa scholasticasame genus2.0%Euxoa campestrissame genus2.3%Euxoa redimiculasame genus2.3%Euxoa foeminalissame genus2.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS2

animal barcodefungal barcode

08Occurrence & distribution

Record type1 251 records

Wild obs. + sensor245

Museum / vouchered1 005

Other1

Range

Area of Occupancy AOO1 644 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy75% within 1 km

≤100 m 113≤1 km 55≤10 km 36>10 km 19

223 georeferenced · 22 without coordinates

Open the mapobservation + sensor245

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy56% within 1 km

≤100 m 65≤1 km 140≤10 km 147>10 km 14

366 georeferenced · 639 without coordinates

Open the institutions mapphysical evidence1 005

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 24 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Alberta Museums (UAM)location not on record	277
Garðabær, IS	158
Edmonton, CA	153
New Haven, US	90
Vernal, US	52
Royal Saskatchewan Museumlocation not on record	47
Oregon State Arthropod Collectionlocation not on record	42
East Lansing, US	35
Colorado State Universitylocation not on record	27
St. Paul, US	21
Brussels, BE	18
University of Guelph, Centre for Biodiversity Genomicslocation not on record	14
RBINS-Scientific Heritagelocation not on record	11
KWPlocation not on record	10
Tartu, EE	4
Denver, US	4
DanishLepidopterologicalSocietylocation not on record	4
Helsinki, FI	3
Natural History Museum of Utahlocation not on record	2
ASUlocation not on record	1
SLU Artdatabankenlocation not on record	1
Centre for Biodiversity Genomicslocation not on record	1
University of Alaska Museumlocation not on record	1
WWUlocation not on record	1

24 institutions · 977 of 1 005 vouchered records shown · 28 without an institution code

09Environmental DNA3 detections

Where the DNA of Euxoa ochrogaster was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.7 °C 16.1–17.2

Seasonal swing summer↔winter31.4 °C

Max temp (day)22.5 °C 22.1–22.9

Min temp (night)11.0 °C 9.40–12.6

Precipitation76.6 mm/mo 58.0–95.2

Air humidity52.7 % 50.4–55.0

Moisture balance-44.0 mm/mo -70.7–-17.2

Vapour deficit901 Pa 889–913

Wind speed1.80 m/s 1.40–2.20

Cloud cover52.3 % 45.9–58.7

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Euxoa ochrogaster

At a glance

Sources7 archives

At a glance

Record type1 251 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions10 of 24 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 251 records