Euxoa obeliscoides

Guenée, 1852 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Euxoa

At a glance

Occurrence records991

Data sources7

Biological traits0

DNA specimens31

eDNA detections34

Sources7 archives

Databases and archives Euxoa obeliscoides's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility991 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI34 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics31 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF991 records

Environmental DNA1 datasets · 2 countries34 detections

DNA & barcodingBOLD31 specimens

01Narrative

Euxoa obeliscoides, known generally as the obelisk dart or square-spot dart, is a species of cutworm or dart moth in the family Noctuidae. It is found in North America. The MONA or Hodges number for Euxoa obeliscoides is 10817.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding31 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Euxoa obeliscoides has left across the world's sequence archives.

At a glance

DNA specimens31

BINs1

Marker genes1

eDNA detections34

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus28 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 3 variable positions, in barcode order

82Cmostly conserved

85Amostly conserved

103Cmostly conserved

AACATTATATTTTATTTTTGGTATTTGAGCAGGAATAATTGGTACTTCCTTAAGTTTATTAATTCGAGCTGAATTAGGAAACCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.16%

Haplotypes9

BIN1

Most divergent pair0.61%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Euxoa spumatasame genus2.3%Euxoa punctigerasame genus2.4%Euxoa stigmatalissame genus2.4%Euxoa oberfoellisame genus3.0%Euxoa brevipennissame genus3.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type991 records

Wild obs. + sensor269

Museum / vouchered722

Range

Area of Occupancy AOO1 828 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy76% within 1 km

≤100 m 142≤1 km 25≤10 km 26>10 km 26

219 georeferenced · 50 without coordinates

Open the mapobservation + sensor269

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy46% within 1 km

≤100 m 105≤1 km 95≤10 km 204>10 km 33

437 georeferenced · 285 without coordinates

Open the institutions mapphysical evidence722

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 26 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Colorado State Universitylocation not on record	225
University of Alberta Museums (UAM)location not on record	138
New Haven, US	123
East Lansing, US	40
San Diego, US	21
Helsinki, FI	20
Oregon State Arthropod Collectionlocation not on record	20
Vernal, US	20
Royal Saskatchewan Museumlocation not on record	13
Denver, US	10
St. Paul, US	9
King Saud Universitylocation not on record	9
ASUlocation not on record	8
UNHClocation not on record	8
UDlocation not on record	4
Cleveland Museum of Natural History, OH (CLEV)location not on record	3
WWUlocation not on record	3
Essig Museum of Entomologylocation not on record	3
US	3
Cambridge, US	3
Centre for Biodiversity Genomicslocation not on record	2
Cornell University Insect Collectionlocation not on record	2
University of Guelph, Centre for Biodiversity Genomicslocation not on record	2
Toronto, CA	1
München, DE	1
Albuquerque, US	1

26 institutions · 692 of 722 vouchered records shown · 30 without an institution code

09Environmental DNA34 detections

Where the DNA of Euxoa obeliscoides was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found34

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 34 detections have coordinates

Open the map2 countries0

4. Native Grassland | 4.4. Temperate Grassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.6 °C 6.60–20.7

Seasonal swing summer↔winter24.7 °C

Max temp (day)24.9 °C 12.9–28.0

Min temp (night)11.0 °C 1.70–14.5

Precipitation28.0 mm/mo 15.2–39.8

Air humidity51.6 % 47.1–57.9

Moisture balance-77.5 mm/mo -106–3.90

Vapour deficit974 Pa 419–1,178

Wind speed1.90 m/s 1.50–4.30

Cloud cover34.1 % 31.0–46.0

CHELSA 1981–2010, ~9 km grid, at location & month of 33 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)