Euxoa brevipennis

Smith · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Euxoa

At a glance

Occurrence records268

Data sources7

Biological traits0

DNA specimens11

eDNA detections6

Sources7 archives

Databases and archives Euxoa brevipennis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility268 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF268 records

Environmental DNA1 datasets · 2 countries6 detections

DNA & barcodingBOLD11 specimens

01Narrative

Euxoa brevipennis is a moth of the family Noctuidae first described by Smith in 1888. In Canada, it is found in British Columbia, Alberta and Saskatchewan. In the United States, it has been recorded from Utah, Colorado and California. The wingspan of the moth is about 33 mm.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Euxoa brevipennis has left across the world's sequence archives.

At a glance

DNA specimens11

BINs1

Marker genes1

eDNA detections6

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus10 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 93% of positions are identical in every specimen.

Where individuals differ — all 43 variable positions, in barcode order

38Amostly conserved

43Tmostly conserved

49Tmostly conserved

55Tmostly conserved

56Tmostly conserved

82Tmostly conserved

85Amostly conserved

118Tmostly conserved

133Cvariable

181Amostly conserved

187Tmostly conserved

193Cmostly conserved

196Amostly conserved

220Tmostly conserved

223Tmostly conserved

229Amostly conserved

235Cmostly conserved

265Cmostly conserved

283Cmostly conserved

302Gmostly conserved

328Amostly conserved

349Cmostly conserved

364Tmostly conserved

394Tmostly conserved

403Avariable

415Avariable

428Cmostly conserved

451Cmostly conserved

463Tmostly conserved

477Gmostly conserved

484Tmostly conserved

487Cmostly conserved

505Tmostly conserved

508Tmostly conserved

533Tmostly conserved

541Amostly conserved

547Tmostly conserved

595Tmostly conserved

607Tmostly conserved

616Tmostly conserved

622Gmostly conserved

637Tmostly conserved

646Tmostly conserved

AACATTATATTTTATTTTTGGTATTTGAGCAGGAATAATTGGTACTTCTTTAAGTTTATTAATTCGAGCTGAATTAGGAAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.7%

Haplotypes5

BIN1

Most divergent pair5.9%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Euxoa spumatasame genus2.3%Euxoa punctigerasame genus2.4%Euxoa stigmatalissame genus2.7%Euxoa simonasame genus3.0%Euxoa pleuriticasame genus3.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type268 records

Wild obs. + sensor12

Museum / vouchered256

Range

Area of Occupancy AOO276 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy25% within 1 km

≤1 km 3≤10 km 4>10 km 5

12 georeferenced

Open the mapobservation + sensor12

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy72% within 1 km

≤100 m 92≤1 km 4≤10 km 35>10 km 3

134 georeferenced · 122 without coordinates

Open the institutions mapphysical evidence256

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Colorado State Universitylocation not on record	95
University of Alberta Museums (UAM)location not on record	46
Oregon State Arthropod Collectionlocation not on record	44
ASUlocation not on record	14
New Haven, US	11
San Diego, US	11
Vernal, US	11
St. Paul, US	7
East Lansing, US	6
Natural History Museum of Utahlocation not on record	3
WWUlocation not on record	3

11 institutions · 251 of 256 vouchered records shown · 5 without an institution code

09Environmental DNA6 detections

Where the DNA of Euxoa brevipennis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.9 °C 6.50–16.3

Seasonal swing summer↔winter24.4 °C

Max temp (day)19.2 °C 13.5–23.2

Min temp (night)7.50 °C 0.6–10.2

Precipitation33.0 mm/mo 17.4–52.8

Air humidity48.6 % 44.3–54.3

Moisture balance-50.5 mm/mo -97.9–-18.7

Vapour deficit655 Pa 504–1,040

Wind speed3.70 m/s 2.50–4.40

Cloud cover35.0 % 24.1–40.7

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)