Euxoa niveilinea

Grote, 1882 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Euxoa

At a glance

Occurrence records216

Data sources7

Biological traits0

DNA specimens5

eDNA detections5

Sources7 archives

Databases and archives Euxoa niveilinea's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility216 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF216 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingBOLD5 specimens

01Narrative

Euxoa niveilinea is a species of cutworm or dart moth in the family Noctuidae. It is found in North America. The MONA or Hodges number for Euxoa niveilinea is 10831.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Euxoa niveilinea has left across the world's sequence archives.

At a glance

DNA specimens5

BINs2

Marker genes1

eDNA detections5

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 19 variable positions, in barcode order

7Gmostly conserved

43Amostly conserved

88Gmostly conserved

133Cmostly conserved

211Amostly conserved

220Cmostly conserved

238Tmostly conserved

274Cmostly conserved

316Amostly conserved

337Gmostly conserved

343Cmostly conserved

352Gvariable

355Tmostly conserved

367Cvariable

370Amostly conserved

539Tmostly conserved

607Tmostly conserved

616Tmostly conserved

619Tmostly conserved

AACATTGTATTTTATTTTTGGTATTTGAGCAGGAATAGTTGGATCTTCTTTAAGATTATTAATTCGAGCTGAATTAGGAAATCCAGGGTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.2%

Haplotypes3

BINs2

Most divergent pair2.6%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Euxoa diaphorasame genus2.9%Euxoa obeliscasame genus3.0%Euxoa velleripennissame genus3.0%Euxoa inconcinnasame genus3.0%Euxoa cinnabarinasame genus3.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type216 records

Wild obs. + sensor12

Museum / vouchered204

Range

Area of Occupancy AOO256 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy42% within 1 km

≤100 m 3≤1 km 2≤10 km 5>10 km 2

12 georeferenced

Open the mapobservation + sensor12

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy55% within 1 km

≤100 m 65≤1 km 24≤10 km 53>10 km 20

162 georeferenced · 42 without coordinates

Open the institutions mapphysical evidence204

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Colorado State Universitylocation not on record	92
East Lansing, US	63
St. Paul, US	21
ASUlocation not on record	6
King Saud Universitylocation not on record	4
New Haven, US	3
Denver, US	3
University of Alberta Museums (UAM)location not on record	2
Philadelphia, US	1
Mississippi State, US	1
Helsinki, FI	1
München, DE	1
US	1

13 institutions · 199 of 204 vouchered records shown · 5 without an institution code

09Environmental DNA5 detections

Where the DNA of Euxoa niveilinea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.9 °C 16.9–17.0

Seasonal swing summer↔winter24.4 °C

Max temp (day)24.9 °C 24.4–24.9

Min temp (night)11.0 °C 10.7–11.0

Precipitation30.8 mm/mo 30.8–31.6

Air humidity48.1 % 47.2–48.1

Moisture balance-92.8 mm/mo -92.8–-77.6

Vapour deficit999 Pa 999–1,023

Wind speed4.10 m/s 3.30–4.10

Cloud cover25.9 % 22.1–25.9

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)