Euxoa laetificans

Smith, 1894 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Euxoa

At a glance

Occurrence records200

Data sources7

Biological traits0

DNA specimens6

eDNA detections5

Sources7 archives

Databases and archives Euxoa laetificans's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility200 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF200 records

Environmental DNA1 datasets · 2 countries5 detections

DNA & barcodingBOLD6 specimens

01Narrative

Euxoa laetificans is a species of cutworm or dart moth in the family Noctuidae. It is found in North America. The MONA or Hodges number for Euxoa laetificans is 10829.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Euxoa laetificans has left across the world's sequence archives.

At a glance

DNA specimens6

BINs1

Marker genes1

eDNA detections5

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.34%

Haplotypes1

BIN1

Where individuals differ — all 4 variable positions, in barcode order

14Avariable

508Cmostly conserved

526Gmostly conserved

598Amostly conserved

AACATTATATTTTATTTTTGGTATTTGAGCAGGAATAGTTGGAACTTCTTTAAGATTATTAATTCGAGCTGAATTAGGAAATCCAGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Euxoa hollemanisame genus1.7%Euxoa henriettasame genus2.0%Euxoa plagigerasame genus2.4%Euxoa atristrigatasame genus2.6%Euxoa munissame genus2.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type200 records

Wild obs. + sensor9

Museum / vouchered191

Range

Area of Occupancy AOO244 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy33% within 1 km

≤100 m 1≤1 km 2≤10 km 6

9 georeferenced

Open the mapobservation + sensor9

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy45% within 1 km

≤100 m 10≤10 km 12

22 georeferenced · 169 without coordinates

Open the institutions mapphysical evidence191

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Alberta Museums (UAM)location not on record	73
Oregon State Arthropod Collectionlocation not on record	62
Vernal, US	18
St. Paul, US	10
Colorado State Universitylocation not on record	10
East Lansing, US	4
New Haven, US	3
Denver, US	2
ASUlocation not on record	2
Natural History Museum of Utahlocation not on record	1
Royal Saskatchewan Museumlocation not on record	1

11 institutions · 186 of 191 vouchered records shown · 5 without an institution code

09Environmental DNA5 detections

Where the DNA of Euxoa laetificans was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.5 °C 12.9–22.2

Seasonal swing summer↔winter28.6 °C

Max temp (day)25.9 °C 20.3–29.5

Min temp (night)13.1 °C 7.80–15.0

Precipitation32.6 mm/mo 18.8–35.4

Air humidity52.3 % 43.0–52.9

Moisture balance-108 mm/mo -136–-56.1

Vapour deficit1,025 Pa 708–1,534

Wind speed3.90 m/s 2.20–4.50

Cloud cover32.0 % 21.7–38.9

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)