Euxoa munis

Grote, 1879 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Euxoa

At a glance

Occurrence records224

Data sources7

Biological traits0

DNA specimens4

eDNA detections5

Sources7 archives

Databases and archives Euxoa munis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility224 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF224 records

Environmental DNA1 datasets · 2 countries5 detections

DNA & barcodingBOLD4 specimens

01Narrative

Euxoa munis is a species of cutworm or dart moth in the family Noctuidae. It is found in North America. The MONA or Hodges number for Euxoa munis is 10855.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Euxoa munis has left across the world's sequence archives.

At a glance

DNA specimens4

BINs1

Marker genes1

eDNA detections5

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 4 variable positions, in barcode order

157Tmostly conserved

343Cmostly conserved

364Tmostly conserved

596Cvariable

AACATTATATTTTATTTTTGGTATTTGAGCAGGAATAGTTGGAACTTCCTTAAGATTATTAATTCGAGCTGAATTAGGAAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.33%

Haplotypes3

BIN1

Most divergent pair0.61%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Euxoa henriettasame genus2.1%Euxoa nevadasame genus2.1%Euxoa plagigerasame genus2.3%Euxoa hollemanisame genus2.3%Euxoa aequalissame genus2.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type224 records

Wild obs. + sensor8

Museum / vouchered216

Range

Area of Occupancy AOO340 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 4≤1 km 3

7 georeferenced · 1 without coordinates

Open the mapobservation + sensor8

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy80% within 1 km

≤100 m 26≤1 km 41≤10 km 17

84 georeferenced · 132 without coordinates

Open the institutions mapphysical evidence216

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Colorado State Universitylocation not on record	71
University of Alberta Museums (UAM)location not on record	61
Oregon State Arthropod Collectionlocation not on record	30
Royal Saskatchewan Museumlocation not on record	20
New Haven, US	10
St. Paul, US	10
San Diego, US	5
Vernal, US	2
Natural History Museum of Utahlocation not on record	1
ASUlocation not on record	1
East Lansing, US	1

11 institutions · 212 of 216 vouchered records shown · 4 without an institution code

09Environmental DNA5 detections

Where the DNA of Euxoa munis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.9 °C 16.9–21.1

Seasonal swing summer↔winter26.9 °C

Max temp (day)24.6 °C 23.8–27.3

Min temp (night)12.4 °C 10.3–14.9

Precipitation31.9 mm/mo 9.90–54.7

Air humidity49.9 % 41.1–55.6

Moisture balance-133 mm/mo -155–-71.4

Vapour deficit1,043 Pa 861–1,463

Wind speed4.00 m/s 2.30–4.50

Cloud cover34.4 % 12.9–35.9

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)